Мк 1а крот: Мотокультиватор КРОТ МК-1А – купить в Москве, цена 8 000 руб., продано 22 мая 2018 – Сад и огород


Мотокультиватор КРОТ МК-1А-02 – ИП Дубин, город Омск

Мотокультиватор – это сельскохозяйственная машина, оснащенная двигателем внутреннего сгорания, которая предназначена для обработки почвы, проведения рыхления, борьбы с сорными растениями, окучивания, влагосбережения. Различают два основных вида данных сельскохозяйственных машин: пропашные и паровые. Паровые мотокультиваторы предназначены для подготовки грунта к посеву, а пропашные используются после посева для улучшения его состояния.

Основной рабочий инструмент данного устройства – насаженные на горизонтальный вал фрезы, при помощи которых происходит разрыхление почвы. Основное отличие от мотоблока заключается в меньшей мощности. Мотоблок имеет больше возможностей в плане навесного оборудования, а также оснащен мощным двигателем с механической коробкой передач, что дает возможность перевозки людей и небольших грузов. Достоинством мотокультиватора является его небольшой вес и компактность, что позволяет обрабатывать при помощи данного агрегата ограниченные участки территории, междурядья, пространство около деревьев и кустарников, клумбы и прочее.

Используются данные машины на малых и средних приусадебных участках, различают легкие, средние и тяжелые типы данных устройств. Оснащаются данные сельскохозяйственные агрегаты двухтактным или четырехтактным двигателем. Первые обеспечивают больший запас моторесура, вторые – большую тяговую силу, что позволяет обрабатывать более сложные участки.

Мотокультиватор КРОТ МК-1А-02 был разработан, а затем пущен в серийную продукцию еще при союзе. Конструкция не один раз пересматривалась и модернизировалась под конкретные нужды, поэтому данную сельскохозяйственную машину можно легко назвать надежной, практичной и простой в использовании, купить его можно тут. В конструкции данного агрегата используется проверенный двухтактный двигатель с воздушным способом охлаждения, рассчитанный на многие годы продолжительной работы. Мощность данного устройства составляет 1,9 кВт, что при номинальном уровне оборотов в 6500в минуту дает отличные показатели по скорости обработки грунта. Топливом для КРОТА будет смесь автомобильного бензина марки А-76 и АИ-80 и с добавлением машинного масла М-12ТП. Объем топливного бака у КРОТА составляет 1,8 литра, чего достаточно для 2-3 часов работы на участке. Ширина обработки почвы достигает 600 мм, а при посадке меньшей фрезы – 350 мм. Габаритные размеры довольно скромные – 1300x810x1060 мм, что при массе в 48 кг предоставляет значительный ресурс мобильности.

Мотокультиватор Крот МК-1А-02 — характеристики, сфера применения

В конце 1980-х годов прошлого столетия на российских машиностроительных заводах стали производить конструкционно легкие и простые мотокультиваторы «Крот»-1А-02. Первые модели МК-1А-02 были оснащены двухтактным двигателем, его мощность достигала 2,6 лошадиных сил. Также этот агрегат имел редуктор, прикрепленный болтиками к раме. На электромотор закреплялся веревочный не съемный стартер. Агрономы отмечали, что устройство обладало небольшой производительностью электродвигателя. После таких отзывов производители решили существенно усовершенствовать агромашины, в частности, увеличив мощность агрегатов.

В данной статье мы подробно рассмотрим основные характеристики, которыми обладает мотокультиватор «Крот»-1А, поговорим о сфере применения данной сельхозтехники, расскажем, какие запчасти и навесные элементы можно дополнительно ставить на «Крот» мотокультиватор «Крот» МК-1А-02.

Основные технические спецхарактеристики

«Крот» 1 мотокультиватор оснащается карбюраторным 2-тактным электродвигателем мощностью 2,6 лошадиных сил с воздушной охлаждающей системой и редуктором. И электродвигатель, и редуктор зафиксированы болтами к раме. Мотор на культиватор «Крот» MK-1А становится бензиновый. На электромоторе фиксируется веревочный не съемный стартер. Данная агромашина также оснащена топливным бачком объемом 1,8 литра. Мотокультиватор «Крот» «Крот»-1А успешно работает на бензине АИ-80 или А-76 (с маслом М-12ТП). Масса агромашины составляет 48 килограмм.

Еще одна важная техническая характеристика — это руль. Он оснащен первоклассными элементами управления, в частности:

  • pучками сцeплeния и pучками для проведения pегулиpования дpоссельной заслонки;
  • управляющим рычагом карбюраторной заслонки.

Мотокультиватор «Крот» MK-1А обладает навесными конструкциями. Их можно приспособить для окучивания, пропалывания, поливочных работ, скашивания травы.

Сфера применения

Культиватор «Крот»-1А справедливо считается одним из самых первых российских агромашин сельскохозяйственной мало габаритной агротехники, которая используется с целью провести не глубокую обработку (фразерование без пластового оборота) — до 30 сантиметров, — боронование, разрыхление, пропалывание междурядий и выравнивание. Как написано в инструкции по эксплуатации, «Крот» мотокультиватор «Крот» МК-1А-02 эффективно использовать на собственных садовых, огородных, приусадебных участках, обрабатываемая площадь которых находится в пределах 0,04-0,10 гектаров. Более подробно об этом можно прочитать, открыв специальную брошюру «Мотокультиватор MK-1А-02 «Крот» инструкция по эксплуатации МК-1А- 02 ».

Мотокультиватор «Крот» МК-1А-02 является не заменимым агропомощником для любого агронома и человека, тесно связанного с сельским хозяйством. Мотокультиватор «Крот» МК-1А имеет компактные размеры, при этом, эта агромашина достаточно высокопроизводительная. Она способна очень быстро и беспроблемно подготовить к посадке почву, окучивать и пропалывать грядки. Мотокультиватор «Крот» «Крот»-1А идеально подходит также для посадке различных сельскохозяйственный культур, например, картофеля.

Фрезы и другие дополнительные детали к агромашине
Важное значение имеют запчасти на мотокультиватор «Крот» МК-1А-02. В набор к устройству при покупке прилагаются четыре фразы. Их нужно зафиксировать с разных сторон редукторного вала. Как вариант, можно одновременно применять шесть фрезов.

Чтобы выкапывать или окучивать картофель, фрезы заменяются другими запчастями на мотокультиватор «Крот» МК-1А-02 — колесами. А сошник заменяется плугом или окучивателем.

Для проведения поливочных работ, используют такие запчасти, как насосное агрооборудование МНУ-2. Оно прикрепляется впереди агросистемы, к нему дополнительно прикрепляется клиноременная передача (ее можно отсоединить от мотоблочного редуктора).

Надеемся, что данная статья помогла Вам составить самое полное впечатление о работе данного вида оборудования, разобраться во всех функциональных нюансах и сфере использования описанной агротехники.

Электрическая схема зажигания мотоблока крот мк 1а. Правильная установка зажигания на мотокультиватор крот

Если вы ищите оптимальное соотношение цены и качества рекомендуем вам обратить внимание на отечественный мотоблок Крот, что выпускается с 83 года. Мотоблок выпускается и по сегодняшний день в московском и омском машиностроительном заводе. В последние годы высококачественные технические характеристики позволяют ему с успехом конкурировать со многими зарубежными агрегатами. Но бывает и моменты, когда вы не знаете, почему мотоблок Крот не заводится или он плохо заводится или в нем нет искры. Может, необходим ремонт стартера, а, может, неисправно работает зажигание. В общем, с этим вопросом и причинами стоит тщательно разобраться.

Устройство мотоблока Крот

Мотоблоки, которые характеризовались простотой конструкции, начали выпускаться больше сорока лет тому. Первые модели были оборудованы недостаточно мощным двигателем и могли использоваться только в узком спектре работ.

Первые покупатели Крота были не очень довольны недостаточной мощностью силового агрегата, в результате многочисленных жалоб мотоблок начали усовершенствовать. На сегодняшний день модель Крот является самой успешной и универсальной моделью отечественных культиваторов, среди всех, представленных на рынке.

Малый по параметрам, он может быть использован в разных целях: прополка, рыхление, боронование, выравнивание. Мотоблок может использоваться даже на небольшом земельном участке, площадь которого не превышает 10 соток.

Если случилось так, что культиватор Крот упрямо не хочет заводиться, его мотор глохнет или пропала искра, то это, скорее всего, свидетельствует о неправильном уходе за системой зажигания. Ниже рассмотрим самые распространенные причины поломки и изучим, как завести мотокультиватор Крот.

Что следует предпринять, если культиватор Крот не заводиться?

В первую очередь вы должны внимательно осмотреть свечу. Для этого ее необходимо выкрутить и проверить на наличие нагара или повреждений. При необходимости купите новую свечу. Монтаж нового элемента системы зажигания выполняется только после предварительной установки уплотнительного кольца. Оно вкручивается до упора сначала рукой, а затем свечным ключом. Вместе с тем, не нужно стараться как можно сильнее вкрутить элемент, так как он может треснуть, или сорвется резьба головки цилиндра.

После выполнения всех операций, наденьте на свечу проволочный угольник и крепко прижмите свечу ее основанием к цилиндру. Далее оберните основание детали электродами, наматывая их в противоположную сторону от отверстия. Далее несколько раз покрутите коленчатый вал двигателя, используя шнур стартера. Если система зажигания исправна, то вы заметите голубую искру между электродами свечи. Если искры нет, или она имеет другой цвет, то система зажигания мотокультиватора работает неправильно.

Частые причины поломки системы зажигания

Нередко культиватор Крот не удается завести из-за ряда других неисправностей, Все они связаны с системой зажигания агрегата. К поломкам относится:

Особенности самостоятельного ремонта культиватора

Если вы выяснили, почему не заводиться ваш культиватор Крот, значит, самое время приступить к ремонту. Так как чаще всего суть проблемы кроется в нарушении дистанции между магнитным башмаком и статором, то необходимо рассмотреть особенности ремонта этой поломки.

Алгоритм ремонтных работ выглядит следующим образом:

Выполнив эти операции, нужно проверить наличие искры на массе корпуса. Для этого посредством стартера прокрутите коленчатый вал. Если искры нет, значит, стартер потребуется немедленно заменить.


Как завести мотокультиватор Крот?

Культиватор Крот пользуется огромной популярностью среди всех производителей подобных агрегатов. Его успех можно объяснить простой незаурядной конструкцией, легкостью в обслуживании, идеальным соотношением цены и качества. Рано или поздно любой технике свойственно выходить из строя. Такая участь иногда случается и с культиваторами. Происходит это по разным причинам, может быть изношена какая-то деталь, а может просто владелец не придерживался всех условий по эксплуатации данного агрегата. Таким образом, как не крути, а ремонтировать технику нужно. Но в этом случае вы можете все сделать сами воспользовавшись руководством по эксплуатации. Также можно обратиться к специалистам, которые устранят неполадки быстро и качественно.

Почему не заводится культиватор Крот и что нужно делать в этом случае?

  1. Нужно проверить уровень масла.
  2. Проверяем, есть ли топливо в баке.
  3. Смотрим, в каком состоянии находится свеча зажигания.
  4. В каком положении находится рычаг управления.
  5. Проверяем, поступает ли в карбюратор топливо.

Что делать, если мотокультиватор не заводится по причине электрозажигания?

  1. В первую очередь нужно выкрутить свечу. Сухая свеча будет свидетельствовать о том, что в карбюратор не поступает бензин.
  2. Если вы столкнулись с тем, что свеча мокрая, тогда нужно просто прокачать движок и высушить цилиндр.
  3. В случае, когда на свечи есть нагар, нужно обязательно ее очистить шкуркой, которую предварительно слегка смочить в бензин.
  4. И проверяем зажигание на наличие искры. Для этого просто проворачиваем коленвал, если все нормально в системе зажигания, тогда вы увидите яркую свечу бело-голубого оттенка.

В чем еще может проблема?

  • Отсутствие искры может быть знаком того, что уже пора заменить свечу.
  • Также может быть выставлен неправильный зазор между проводом зажигания и катушкой.
  • Причина может крыться и в топливном шланге. В случае, когда пластины махового колеса прилегают к проводам магнето.

Если после такой самостоятельной диагностики агрегат все же не заводится, тогда стоит обратиться к специалистам в сервисный центр. Они смогут быстро и эффективно устранить поломку и сделать качественную диагностику всех систем вашего мотокультиватора.

comments powered by HyperComments


Двигатель для мотокультиватора “Крот”: установка, ремонт, замена

Мотокультиватор, как и любая другая техника, предполагает необходимость своевременного обслуживания и ремонта. Если вы не намерены обращаться к специалистам и хорошо разбираетесь в машиностроении, то обнаружить неисправность и восстановить работоспособность устройства сможете самостоятельно.

Проблема с подачей топлива

Указывать на то, что двигатель для мотокультиватора «Крот» вышел из строя, может отсутствие возможности завести оборудование. Причиной в этом случае может стать и система запуска. Мастер должен определить источник поломки, для этого проверяется состояние свечей зажигания. Если они сухие, то это указывает на то, что топливная смесь не нагнетается в цилиндр мотором. Привести к этому может засорение отверстия в пробке бензобака, отсутствие топлива и наличие посторонних предметов в системе подачи топлива. Вызвать неисправность может закрытый кран подачи топлива.

Устранение проблемы

Если двигатель для мотокультиватора «Крот» не заводится, то нужно открыть топливный бак, освободить дренажные отверстия от посторонних предметов, а также снять топливный кран. Из бака следует слить бензин, а после промыть внутренние поверхности чистым топливом. Мастеру предстоит изъять соединительный шланг, который находится со стороны карбюратора. Эти манипуляции необходимы для того, чтобы продуть его вместе с жиклерами без разборки последнего. При этом рекомендуется использовать топливный насос.

Неисправности двигателя при запуске

Если двигатель для мотокультиватора «Крот» не запускается, несмотря на то что свечи влажные, проблема отказа системы зажигания может состоять в том, что на электродах свечей присутствует нагар. В этом случае оператору предстоит очистить поверхность свечей, используя наждак. После этого элементы промываются бензином и хорошо высушиваются. Причина неполадки может состоять еще и в том, что зазор между электродами не соответствует тому, который рекомендован производителем. Отрегулировать зазор можно методом подгибания бокового электрода до необходимых размеров.

Дополнительные причины отказа системы зажигания

Двигатель для мотокультиватора «Крот» может не работать еще и по той причине, если изоляторы свечей оказались повреждены. Это касается и неисправной проводки. Эти элементы обязательно необходимо подвергнуть замене. Клавиша «Стоп» может быть замкнута на массу, для того чтобы запустить мотор, от замыкания следует избавиться. Нарушенными могут оказаться и контакты угольников свечей, если это условие соблюдается, то контакты нужно привести в порядок. Мотокультиватор «Крот» с двигателем «Хонда» может не запускаться, если зазор между стартером и магнитным башмаком не соответствует значению, упомянутому в паспорте. Стартер необходимо будет заменить, если на нем были обнаружены дефекты.

Нарушение компрессии

В процессе эксплуатации может потребовать ремонта мотокультиватор «Крот». Двигатель Honda, например, в некоторых случаях “радует” нарушением компрессии. При этом запуск произвести возможно, но этот процесс достаточно затруднен. Мотор будет работать неустойчиво, а развить достаточную мощность у него не получится. В качестве причины может выступить появление нагара на рабочих поверхностях клапанов. Выпускной клапан достаточно часто деформируется, а поршневые кольца изнашиваются, все это приводит к затруднительному запуску оборудования.

Восстановление компрессии

Если вы приобрели мотокультиватор «Крот», ремонт двигателя может понадобиться через некоторое время. Когда потребитель сталкивается с вышеописанными проблемами, необходимо проанализировать, каково состояние механизма газораспределения мотора. Детали, на которых осел нагар, необходимо очистить. Если же некоторые запчасти оказались повреждены, их нужно заменить. Оператору следует проверить, насколько хорошо сохранились поршневые кольца. В случае неисправности этого узла его нужно будет подвергнуть замене.

Черный дым из глушителя в процессе работы мотора

Если вы столкнулись с подобными неполадками, а на электродах свечей был замечен избыток масла, то нужно, скорее всего, выполнить регулировку карбюратора, заменить вышедшие из строя поршневые кольца.

Установка двигателя

Установка двигателя на мотокультиватор «Крот» может быть осуществлена самостоятельно. Однако следует понимать, что если работы будут проведены без соблюдения технологии, то ошибка может стать причиной быстрого выхода из строя оборудования. При этом вы столкнетесь с длительной дисфункцией прибора, пока проблема не будет устранена. Если вы не хотите лишиться столь необходимой для выполнения множества задач техники, то к проведению работ следует подойти с ответственностью.

На первом этапе от двигателя к коробке передач передается крутящий момент. Двигатель должен быть надежно укреплен к раме конструкции или коробке передач. Для проведения работ будет необходимо купить специальный установочный комплект, который позволит монтировать двигатель на место. На приобретенную площадку из установочного комплекта нужно будет зафиксировать новый двигатель. На следующем этапе шкив надевается на выходной коленчатый вал агрегата. Если воспользоваться установочным комплектом, то монтаж двигателя вы сможете осуществить за считанные минуты. При этом можно будет использовать мотор импортного производства, установив его на агрегат, выпущенный отечественным заводом.

Проведение замены двигателя

Замена двигателя на мотокультиватор «Крот» достаточно часто производится пользователями самостоятельно. Первоначально оборудование снабжается двигателем на 2,4 л. с. Если движок вышел из строя, а заводить его можно, но с большими проблемами, иногда применяют электродрель в роли стартера. Если вы столкнулись с описанными проблемами, которые дополняются тем, что оборудование глохнет после нагрева, то причиной может стать износ сальника движка. При наличии генератора старого образца, который способен выдавать 36 вольт и обладает мощностью в 200 ватт, вы можете использовать этот движок в качестве основы устройства. Потребляет он около 3 литров бензина за час.

Распилив генератор, вы сможете вынуть из него муфту с подшипником и некоторую часть корпуса. Кусок генератора можно будет применить в роли переходника для шкива мотокультиватора. Для формирования второй точки опоры можно приобрести китайские подшипники, закрепив их на вертикальные планки. Этот элемент на ось бывшего генератора можно просто приварить. После того как была произведена замена на такой двигатель, использовать можно будет любой бензин. Как подчеркивают многие пользователи, для того чтобы завести оборудование, можно применять даже керосин. Максимальные обороты, конечно же, будут снижены, но по ощущениям крутящий момент станет больше. Вы должны учесть, что после этого уровень шума увеличится, однако при эксплуатации такого устройства это не критично. Так как и при “родном” двигателе агрегат издает достаточно много шума. Помимо прочего, производитель советует использовать при работе наушники.


Причины и их решения, если мотоблок Крот не заводится

Мотоблоки Крот отечественного производства достойно конкурируют на рынке со многими известными иностранными марками. В первую очередь они берут своей доступностью в цене. Но, как и многой другой технике, так и Кротам соответственно свойственно выходить из лада и огорчать своих владельцев различными неполадками. Сейчас мы поговорим об одной распространенной проблеме с этими агрегатами: как завести мотоблок Крот.

Причины неисправностей запуска двигателя мотоблока:

  1. Засорен воздушный фильтр. Мы его просто заменяем.
  2. Если между электродами свечи отсутствует искра, нужно непосредственно менять саму свечу. Прежде чем установить свечу зажигания, нужно произвести монтаж уплотнительного кольца. При его затяжке не переусердствуйте, чтобы не сорвать резьбу цилиндровой головки.
  3. Если со свечи топливо стекает каплями, тогда нужно просушить цилиндр, просто прокачав двигатель ручным стартером.
  4. Помехой в работе мотоблока может стать нагар на свечи, ее можно починить, очистив ее с помощью шкурки и топлива.
  5. Если все-таки искра есть, но движок на мотоблоке все равно молчит, тогда может просто не быть изоляции из-за влажной или мокрой свечи. В этом случае нужно просто сменить наконечник.
  6. Одной из частых поломок есть выброс пламени из глушителя. К такой поломке может привести деформация шпонки маховика. Как осуществить замену шпонки:
    1. приступаем к разборке храповика стартера;
    2. скрываем корпус муфты;
    3. изымаем маховик и старую шпонку;
    4. устанавливаем новую шпонку;
    5. затягиваем корпус.
  7. Изношенный уплотнитель цилиндра либо между фильтром и карбюратором неправильно установлена прокладка. В этом случае нужно просто произвести замену уплотнителей, а также обязательно проверить, правильно ли они закреплены.
  8. В карбюратор не поступает топливо. Такое часто случается после длительного зимнего застоя техники в сыром помещении. В таком случае отремонтировать заводку нужно очистив стопорную иглу. Именно вокруг нее собираются все осадки и маслянистые образования, которые и служат помехой для нормальной работы механизма. В этом случае нужно произвести чистку детали.
  9. Используется некачественный бензин или топливо не соответствует двигателю. В этом случае будет намокать искра и потребуется замена наконечника.
  10. Отказ магнето. Для решения этой проблемы деталь заменяем на новую.
  11. Засорение дренажного отверстия в топливном баке. В этом случае нужно его очистить и продуть.

Если вы не уверены в своих технических знаниях и не совсем знаете, как правильно произвести замену детали, разборку механизмов и прочее, тогда стоит обратиться к специалистам. Они смогут быстро найти неисправность и избавиться от нее. Поверьте, это вам обойдется гораздо дешевле, нежели покупать новую технику.

Также помните, что для нормального функционирования вашего мотоблока стоит уделять ему постоянное внимание. А именно регулярно проводить диагностику, проверять исправность деталей и механизмов, производить своевременную замену масла. Это позволит предотвратить множество проблем и продлит срок эксплуатации агрегата.

Прежде чем приступать к самостоятельному ремонту мотокультиватора Крот, надо знать, подлежит ли он гарантийному обслуживанию. Если срок гарантии еще не истек, обратитесь в соответствующую мастерскую. Там технику отремонтируют и продлят гарантию еще на определенное время.

Надо знать, что после первого включения мотоблока, на двигатель не дается полная нагрузка. В инструкции указывается срок обкатки, так как все детали должны пройти притирку, иначе двигатель и редуктор в ближайшее время придется чинить.

Но если Ваш мотоблок уже довольно старый и не имеет гарантийного обслуживания, можно попытаться сделать небольшой ремонт мотокультиватора крот своими руками. Он не очень труден и даже не очень опытный человек справится с этой задачей. «Крот» – несложное устройство. Чтобы правильно всё сделать, предварительно ознакомьтесь с инструкцией и схемой блока, ведь зная устройство машины, можно сделать и ее ремонт.

Частые неисправности

Когда мы говорим о ремонте мотоблока Крот, то стоит перечислить следующие поломки и способы их устранить:

  • Неисправное зажигание – часто встречающая поломка мотоблока Крот. Вначале проверьте свечу — ее выкручивают и осматривают. Сухая свеча говорит о том, что в цилиндр не попадает топливная смесь. Если свеча очень «мокрая», «прокачайте» ручным стартером двигатель — так можно просушить цилиндр. Если на свече много нагара, очистите её мелкой шкуркой и бензином.
  • Зазор между электродами обычно бывает 0,8 мм, если необходимо, отрегулируйте его.

Неисправное зажигание — частая причина ремонта мотокультиватора «Крот»

  • Нет искры . Значит, неисправна свеча, просто поставьте новую (ССЫЛКА на свечи с Алиэкспресс). Также возможно, в электрической цепи отсутствует контакт или нарушен зазор между магнитопроводом и катушкой зажигания.

Зажигание мотоблока Крот зависит от состояния бензиновых шлангов , изоляции высоковольтных проводов и их соединения. Проверьте все тщательно, пластины маховика НЕ ДОЛЖНЫ касаться магнитопроводов магнето. Убедитесь, что следы касания отсутствуют.

  • Нужно проверить воздушный фильтр . Если он загрязнен, в карбюратор поступает недостаточное количество воздуха. Даже грязный глушитель влияет на мощность двигателя.

Вам не удалось найти поломку зажигания? Обратитесь к специалисту, с серьезной проблемой вам самостоятельно не справиться.

Даем небольшую рекомендацию по подбору специалиста для ремонта «Крота» — сайт Профи.ру . Выберите свой город и подыщите мастера, вероятность найти хорошего специалиста очень велика.

Что делать, если проблема в двигателе?

Чаще всего хозяева машин этой марки сталкиваются с неполадками двигателя, например, он не запускается или его работа неудовлетворительная. Среди признаком поломки: самопроизвольная остановка, не набирается мощность, слышатся перебои.

Вот небольшая инструкция, как определить поломку:

  1. Проверьте зажигание;
  2. Убедитесь в наличии в бензобаке топлива;
  3. Если вы сомневаетесь в поступлении топлива в карбюратор, проверьте топливный фильтр;
  4. При необходимости прочистите его;
  5. Запустите холодный двигатель;
  6. Воздушная заслонка карбюратора должна быть в закрытом состоянии.

Если не удается найти причину неисправности мотокультатора Крот и починить ее своими руками, обратитесь к специалисту

Профилактика и правила эксплуатации

Чтобы предупредить неисправности мотокультиватора Крот, необходимо знать элементарные правила его хранения и эксплуатации. Они зависят от того, какой срок техника будет бездействовать.
Если вы не будете пользоваться им длительное время, то вот несколько правил:

  1. Надо запустить двигатель столько раз, чтобы карбюратор остался пустым .
  2. Детали машины, которые перемещаются и вращаются должны быть аккуратно смазаны качественным маслом .
  3. Ежедневное обслуживание обязательно.
  4. Поверхности мотоблока ежедневно протираются ветошью , пропитанной топливной смесью.
  5. При выходе из строя каких-либо деталей устанавливайте новые запчасти .

Если Вы хотите эксплуатировать мотоблок «Крот» длительное время, без ремонта, обязательно пройдите техническое обслуживание. Не покупайте дешевые, «левые» запчасти. Только оригинальные запасные детали обеспечат качественную работу вашей техники после ремонта. Регулярный осмотр и техническое обслуживание — гарантия длительного срока службы.

Видео инструкции

Если у Вас пока еще нет мотокультиватора Крот, но Вы задумываетесь о его покупке, обязательно посмотрите полезнейшее видео о всех достоинствах данной машины:

Эти мотоблоки появились на свет еще в далеких 80-х и по праву считаются отправной точкой в производстве сельскохозяйственной минитехники. Основная задача культиватора Крот, как и ряда минитракторов других производителей, заключается в обработке земельного участка. Обычно это приусадебные территории, огороды и дачи. Чтобы вскопать такие участки лопатой, необходимо потратить немало времени и драгоценного здоровья. Именно мотоблоки приходят на помощь человеку.

Мотоблоки Крот обрели свою популярность еще с 80х годов


Конструкция мотокультиватора состоит из рамы, двигателя, трансмиссии, топливного бака, колесной пары и навесного оборудования. Рама собирается из двух одинаковых полурам, которые закрепляются к редуктору болтовыми соединениями. Изогнутые трубчатые держатели выведены на заднюю часть мотоблока. На этих рукоятках установлены рычаги управления скоростью и сцепления. На концы выходного вала можно надевать колеса, плуги и фрезы, в зависимости от вида выполняемых работ (вспашка, окучивание или транспортировка тележки).

На раму крепится бензиновый двигатель, который соединяется с входным валом на редукторе при помощи ременной трансмиссии. В качестве мотора применяют классический вариант одноцилиндрового двухтактного движка с системой воздушного охлаждения. Объем двигателя составляет 60 кубиков с мощностью 2,6 л.с. Этого вполне хватает для работы на несложных участках почвы. Запускается двигатель ручным способом с помощью веревки. Благодаря широкому выбору силовых агрегатов, теперь у производителей техники появилась возможность устанавливать на свою продукцию более совершенные моторы. Современные модели мотоблока Крот стали комплектоваться больше китайскими мощными четырехтактными двигателями.

В данном видео рассмотрим установку зажигания на мотокультиватор Крот:

Сверху конструкции установлен бензобак. Для транспортировки мотокультиватора существуют подвижные колеса, которые могут подниматься и не мешать во время проведения полевых работ. Малыш уже много лет исправно служит человеку. Основным недостатком считается миниатюрный электронный блок МБ. Дело в том, что это оборудование установлено таким образом, что электронная часть схемы расположена в непосредственной близости с картером двигателя. Во время длительных работ она нагревается до 80 градусов, а тиристор, установленный в плате, рассчитан на 75 градусов максимальной температуры. Отсюда и нестабильная работа двигателя.

Установка зажигания

Любая техника с системой зажигания требует особого внимания и проведения периодической регулировки электронного блока. В противном случае мотокультиватору грозит преждевременный выход из строя. Если система зажигания выставлена некорректно, ее можно отрегулировать самостоятельно. Для этого нужно внимательно ознакомиться со схемой конструкции узла.

Регулировка зажигания в мотокультиваторе Крот считается выполненной правильно, если система создает искру в определенное время и месте. За образование искры несет ответственность верхняя крышка магнето, а за прерывание отвечает нижняя часть.


Данный способ настройки включает в себя следующие действия:

  1. Разогревают двигатель.
  2. Подсоединяют стробоскоп к мотоблочному устройству.
  3. На проволоке высокого напряжения цилиндра подключают датчик звука.
  4. Теперь снимают вакуумный шланг и заглушают его.
  5. Свет, испускаемый стробоскопом, направляют в сторону шкива.
  6. Включают двигатель на холостом ходу.
  7. Поворачивают трамблер и следят за шкивной меткой.
  8. При совпадении меток на крышке мотоблока и шкиве, трамблер закрепляют.
  9. Закручивают гайку-прерыватель.

С помощью лампы

  1. Регулировку начинают с поворота коленчатого вала. Отметка на шкиве должна сравняться с риской на ГРМ. Бегунок должен смотреть на высоковольтный провод цилиндра.
  2. Далее следует отпустить гайку крепления трамблера.
  3. Берут лампочку и подключают ее одним проводом к «массе», а другим – к катушке для создания электрического поля.
  4. Включают зажигание.
  5. Прерыватель прокручивают по направлению хода часовой стрелки до момента, когда лампочка перестанет светиться.
  6. После этого механизм поворачивают в обратную сторону.
  7. При определенном моменте лампа должна вновь засветиться.
  8. В это время гайка трамблера плотно затягивается.

Не забывайте про технику безопасности при установке зажигания на мотоблок

С искры

Все начинается в такой же последовательности, как в методе с лампой:

  1. Поворачивают коленчатый вал, сравнивая метки газового механизма и шкива. Бегунок должен быть повернут в сторону высоковольтного провода цилиндра.
  2. Немного ослабляют гайку прерывателя-распределителя.
  3. Достают наружу провод высокого напряжения из-под системной крышки и размещают его на расстоянии 0,5 сантиметра от мотоблока.
  4. Включают зажигание и поворачивают трамблер к отметке 200.
  5. Далее аккуратно разворачивают механизм в обратную сторону.
  6. Между проводом и «массой» мотоблока должна возникнуть искра.
  7. Теперь быстро затягивают гайку крепления прерывателя, чтобы избежать возможного воспламенения.

Неисправности и причины

В какой-то момент может случиться, что двигатель начинает глохнуть или пропадает искра. Необходимо выяснить причину поломки и первым делом осмотреть свечу зажигания:

  1. Если поверхность свечи сухая, это значит, что бензин попросту не попадает в цилиндр, и нужно искать причину дальше.
  2. При наличии излишнего топлива (горючее стекает по стенкам свечи и капает) нужно прогнать двигатель стартером и подсушить его.
  3. Присутствие нагара свидетельствует об использовании некачественного топлива. Нагар легко удаляется с поверхности свечи воздействием мелкозернистой наждачной бумаги.

Установку новой свечи зажигания производят только после посадки уплотнительного кольца, которое плотно вкручивается специальным свечным ключом. После подсоединения электродов необходимо провернуть коленвал, если все выполнено правильно, то между электродами появиться искра. Она должна быть голубого оттенка. Наличие искры другого цвета означает, что система зажигания мотокультиватора Крот настроена некорректно.

Основные причины нестабильной работы зажигания:

  • нарушение в соединении топливного шланга;
  • плохой контакт электродов;
  • повреждение изоляторов свечи;
  • засорение воздушного фильтра.

Для эффективной работы мотокультиватора следует своевременно проводить профилактические работы и менять изношенные детали на новые. Это позволит не только качественно выполнять сельхозработы, но и продлит срок жизни мотоблоку.

Совет. Во избежание быстрой поломки мотоблока нужно воздержаться от работы в сырую погоду и не нагружать чрезмерно горячий двигатель. Это приводит к преждевременному износу агрегата.

Соблюдение простых правил ухода и эксплуатации позволит владельцу продлить моторесурс как системы зажигания, так и культиватора в целом.

Мотокультиватор Крот ОМ: инструкция по эксплуатации

Описание В начале восьмидесятых годов прошлого столетия владельцам дачных участков и огородов была предложена специализированная техника для механизации

Обзор модельного ряда мотокультиваторов Крот

Крот МК-1

  1. Имеет небольшую мощность (2,6 л.с.).
  2. Примитивное устройство: двигатель (несовершенный), редуктор, рама, рукоятка, кронштейн.

В данном видео произведем обзор мотокультиватора Крот:

Модель мотокультиватора Крот МК-1А

  1. Удобный, небольшой по размерам и весу (всего 48 кг).
  2. Возможность дополнять и расширять эксплуатационные вариации данного средства.
  3. Наличие обратной скорости.

Крот МК 3-А-3

  1. Одна ось.
  2. Достаточно легкий (примерно, 45 кг).

Крот 3 DDE V 800 II

  1. Мощность – 7 л.с.
  2. Двигатель выдерживает долгий период нагрузок, при небольшой затрате топлива.

Крот МК 5-01

  1. Достаточно мощный японский двигатель Honda (4 л.с.).
  2. Также две передачи.

Крот Subaru Robin

  1. Мощный японский двигатель (3,5 или 4,5 л.с.).
  2. Имеет две скорости.

Крот М

  1. Модель с самыми малыми габаритами.
  2. Имеется транспортировочное колесо.
  3. Двигатель Honda.
  4. Легкий (вес – всего 48 кг).

Марка мотоблоков Крот представляет множество разных моделей (от тех, что подешевле к более дорогим, соответственно, с хорошими, мощными деталями для тяжелых длительных работ и немного попроще).

Крот Ом

  1. Двигатель двухтактный, карбюраторный.
  2. Имеет низкую мощность (2 л.с.).
  3. Объем двигателя – 60 см³.
  4. Достаточно легкий аппарат.

Технические характеристики мотокультиваторов Крот МК-1А-01Ц

  1. Малогабаритная сельскохозяйственная техника для неглубокого (25 см) обрабатывания земли, ее рыхления, выравнивания, прополки междурядий и так далее.
  2. Имеет незначительную массу (приблизительно 45 кг).
  3. С помощью дополнительных навесных оружий он может окучивать, пропалывать междурядья, перевозить разные материалы, скашивать траву и т.д.
  4. Новые усовершенствованные детали обеспечивают уменьшенный расход топлива, снижение уровня шума.
  5. Наличие заднего хода.

Крот МК-2

  1. Четырехтактный двигатель (мощность – уже 3,6 л.с.).
  2. Наличие двух скоростей.
  3. Усовершенствованный цепной редуктор.
  4. Может справляться с трудным, твердым грунтом.

Крот МК-9-01

  1. Двигатель четырехтактный бензиновый, мощностью (5,5 л.с.).
  2. Может обрабатывать участки глубиной до 25 см.
  3. Справляется с такими работами: копает, культивирует, рыхлит грядки, выравнивает землю, пропалывают рядки.
  4. Имеет высоконадежный импортный редуктор и уникальную конструкцию фрез (этот мотокультиватор может обрабатывать даже самые тяжелые участки земли).

Крот 05-01

  1. Имеет бензиновый долговечный двигатель модели Honda (4 л.с.) с неплохой сбалансированностью.
  2. Может выполнять множество функций (вспашка, прополка огородов небольшой площади, обработка глинистых грунтов).
  3. Имеет немалый вес (57 кг).
  4. Хороший цепной редуктор с невысокими потерями и долгим временем эксплуатации.
  5. Может двигаться задним ходом.
  6. Оперативно обрабатывает немалые участки земли.
  7. Легкий в применении и освоении.


В начале восьмидесятых годов прошлого столетия владельцам дачных участков и огородов была предложена специализированная техника для механизации аграрных работ – легкий мотокультиватор Крот МК-1 2,6 л.с. Конструкция агрегата была простейшей – редуктор и двигатель на раме, закрепленные с помощью болтов, руль, кронштейн и стартер из простой веревки.

Естественным продолжением стала непрерывная модернизация агрегата, расширение функций, оснащение производительными двигателями, прочными редукторами. Сегодня семейство мотоблоков и мотокультиваторов Крот насчитывает множество различных моделей, которые выпускаются на машиностроительном предприятии им. В.В. Чернышева (г. Москва) и на заводе «Взлет» (г. Омск) с торговой маркировкой «Крот-Ом».

Основные характеристики


Покупка мото культиватора Крот МК-5-01

Мотокультиватор Крот МК-5-01 с четырехтактным двигателем HONDA был куплен в компании


Бензиновый культиватор Dde V750ii КРОТ-2

Купил одновременно МК крот 2 и МБ Урал.

Урал собрал, поставил на работу: замечаний нет, разве что от вибрации переломился крепеж “бампера”, защиты двигателя. Крот же собрал, завел: в двигателе услышал стук при “подготовке”. Пошевелил вал, а у него люфт. Затем прокатил его на фрезах, а у него слетает ремень. Посмотрел, а у валов, по которым ходит ремень, плоскости вращения расходятся примерно на 1 см. Пришлось сдать его по гарантии. По задумке культиватор очень хороший, но сборщики – г….ны. Уважаемые бригадиры, применяйте, пожалуйста, меры физического воспитания к вашим сборщикам!

Использование мотокультиватора Крот

Владельцы дачных участков, огородов, а такие жители сельской местности наверняка оценили по достоинству такую проверенную временем и всевозможными нагрузками агротехнику, как мотокультиватор “Крот”.

Мотокультиватор Крот

Кто же является его производителем? Эта техника появилась на свет в далеких 80-х годах в Советском Союзе на авиационном заводе АО «ММП им. В.В. Чернышева». Производитель культиватора “Крот” подарил всем, кто занимается сельским хозяйством для личных нужд, настоящий мини-комбайн.

Мотокультиватор Крот может выполнить практически любые агротехнические работы:
  • вспашка почв, в том числе и целинных;
  • посадка картофеля;
  • окучивание растений;
  • прополка;
  • сбор урожая картофеля;
  • уборка снега в зимнее время;
  • покос травы;
  • перевозка собранного урожая из одного пункта назначения в другой.


Время идет, технический прогресс ведет нас вперед, и вот уже созданы новые прогрессивные (улучшенные) модели, которые радуют своих владельцев более расширенными функциями.

Желаете узнать все о мотокультиваторе “Крот” — его модификациях, технических характеристиках, особенностях моделей, а также сколько стоит та или иная разновидность культиватора? Ответы на эти вопросы, а также видео обзоры и отзывы потребителя помогут вам определиться с моделью культиватора “Крот”.

Модели мотокультиватора «Крот»:
  • МК-1А
  • МК 3-А-3
  • МК-4-03
  • МК-5-01
  • МК 9-01/02
  • КРОТ-Р

Каждая из указанных моделей моторизированного культиватора также имеет несколько разновидностей, улучшенных модификаций.

Рассмотрим основные характеристики и особенности каждого из представленных агрегатов.


Отметим, что это самый компактный агрегат, оснащенный небольшим двухтактным карбюраторным двигателем (на 2,6 л. с), который, меж тем, в состоянии обработать приличный участок земли. Благодаря своим габаритам востребован для работ в теплицах.

Культиватор этой модели не имеет реверса и способен двигаться вперед всего на одной скорости, но это не убавляет его огромного функционала (возможностей). Сравнительно небольшой вес агрегата (48 кг) позволяет с легкостью его транспортировать в нужном направлении.

Мотокультиватор Крот МК-1А

Технические характеристики
Параметр Значение
  Производитель АО «ММП им. В.В. Чернышева»
  Страна производитель Россия
  Диаметр фрез 33 см.
  Мощность 2.6 л.с.
  Количество скоростей 1 вперед/0 назад
  Реверс Нет
  Рулевая колонка 1 положение
  Ширина захвата 35-60 см.
  Глубина захвата 25 см.
  Вес 48 кг.
  Габариты 1300x810x1060 мм.

МК 3-А-3

Этот агрегат немного габаритнее предыдущего, да и вес уже не 48, а 51 кг. Однако его все еще можно перевозить в багажнике своего авто, либо на крыше. Большая производительность культиватора “Крот” МК 3-А-3 обусловлена большей мощностью двигателя марки GeoTeck, она составляет 3,5 л. с.

Основной отличительной чертой марки МК 3-А-3 от МК-1А является появившаяся функция реверса. Вместе с ней улучшились эксплуатационные характеристики культиватора, а также работать с машиной стало намного удобнее.

Мотокультиватор Крот МК-3-А-3

Технические характеристики
Параметр Значение
  Производитель АО «ММП им. В.В. Чернышева»
  Страна производитель Россия
  Марка двигателя GeoTeck
  Марка двигателя GeoTeck
  Мощность 3.5 л.с.
  Количество скоростей 1 вперед/1 назад
  Реверс Есть
  Ширина захвата 35-60 см.
  Глубина захвата 25 см.


Это агротехническое оборудование имеет 53 кг веса и двигатель марки Briggs&Stratton на 4,0 л. с. Присутствует функция реверса и по одной скорости вперед-назад. В данном мотокультиваторе увеличились глубина и ширина захвата, что позволило ему выполнять агротехнические работы более продуктивно и качественно.

Мотокультиватор Крот МК-4-03

Технические характеристики
Параметр Значение
  Производитель АО «ММП им. В.В. Чернышева»
  Страна производитель Россия
  Марка двигателя Briggs&Stratton
  Марка двигателя Briggs&Stratton
  Мощность 4.0 л.с.
  Сцепление Ременное
  Редуктор Цепной
  Количество скоростей 1 вперед/1 назад
  Реверс Есть
  Рулевая колонка 1 положение
  Ширина захвата 35-90 см.
  Глубина захвата 30 см.
  Вес 53 кг.
  Габариты 1300x810x1060 мм.


Данная модель по своим техническим характеристикам во многом схожа с предыдущей моделью, та же ременное сцепление и цепной редуктор, вес, производительность двигателя, ширина и глубина захвата. Однако в основе устройства приспособлен совсем другой тип двигателя (Honda), отличающийся выносливостью и мощностью (4,0 л. с.).

Компактные размеры и вес в 53 кг позволяют без проблем совершать транспортировку культиватора к выбранному объекту.

Мотокультиватор МК-5-01

Технические характеристики
Параметр Значение
  Производитель АО «ММП им. В.В. Чернышева»
  Страна производитель Россия
  Двигатель GC135
  Марка двигателя Honda
  Двигатель GC135
  Марка двигателя Honda
  Мощность 4.0 л.с.
  Сцепление Ременное
  Редуктор Цепной
  Количество скоростей 1 вперед/1 назад
  Реверс Есть
  Рулевая колонка 1 положение
  Ширина захвата 35-90 см.
  Глубина захвата 30 см.
  Вес 53 кг.
  Габариты 1300x810x1060 мм.

МК 9-01/02

Удобный, функциональный агрегат с мощностью двигателя (марки HAMMERMANN) 5,5 л. с. Этот мотокультиватор способен без особого труда одолеть даже целинные земли. Прочные фрезы и другое навесное (прицепное) оборудование сделали этот культиватор незаменимым помощником на приусадебном участке, небольшом фермерском хозяйстве, в огороде и даже в теплице.  Габариты и вес агрегата не создадут проблем с транспортировкой.

Мотокультиватор Крот МК-9-01

Технические характеристики
Параметр Значение
  Производитель АО «ММП им. В.В. Чернышева»
  Страна производитель Россия
  Марка двигателя HAMMERMANN
  Диаметр фрез 33 см.
  Марка двигателя HAMMERMANN
  Мощность 5.5 л.с.
  Сцепление Ременное
  Редуктор Цепной
  Количество скоростей 1 вперед/1 назад
  Реверс Есть
  Рулевая колонка 1 положение
  Ширина захвата 35-60 см.
  Глубина захвата 25 см.
  Вес 53 кг.
  Габариты 1300x810x1060 мм.


Это агротехническое устройство предназначено для качественной автоматической обработки всех видов почв, посадки и выкопки картофеля, ухода за растениями (прополка, окучка), а также для покоса травы, откачки вод, уборки снега и т. д.

Вместе с мотокультиватором в комплекте идут фрезы диаметром 33 см, остальное оборудование (окучники, косилку, картофелесажалку и копалку можно приобрести отдельно). Многие умельцы самостоятельно изготавливают такие прицепные орудия для мотокультиватора “Крот”, как снегоуборщик и другие.

Мотокультиватор Крот Р

Технические характеристики
Параметр Значение
  Производитель АО «ММП им. В.В. Чернышева»
  Страна производитель Россия
  Двигатель EY-15D
  Марка двигателя Subaru
  Двигатель EY-15D
  Марка двигателя Subaru
  Мощность 3.5 л.с.
  Сцепление Ременное
  Редуктор Цепной
  Количество скоростей 1 вперед/1 назад
  Реверс Есть
  Рулевая колонка 1 положение
  Ширина захвата 60-90 см.
  Глубина захвата 25 см.
  Вес 52 кг.
  Габариты 1300 х 810 х 1060 мм.

Удобная функция реверса (отсутствующая в первых моделях), существенно повышает удобство работы с культиватором. Мощность двигателя марки Subaru составляет 3,5 л. с.

Перевозка мотокультиватора Крот

Картонная коробка с мотокультиватором Крот поместилась на разложенный задний диван Дэу Нексии без всяких проблем. В погрузке участвовало два человека, поскольку вес упаковки составляет примерно 55 кг., и её не очень удобно перемещать одному.

По-видимому, габариты коробки должны были составить 90x40x70 см., но фактически оказались 93x42x70 см. ВНИМАНИЕ: при транспортировке мотокультиватора необходимо строго следить за его вертикальным положением, как это указано на упаковке, поскольку в противном случае возможен разлив масла из редуктора или двигателя.


Направление вращения фрезпрямоеШирина обработки почвы65 смГлубина культивирования25 смКоличество фрез в комплекте4 шт.

Ремонт мотокультиватора своими руками

Мотокультиватор имеет следующие узлы:

  1. Топливная система (карбюратор, бак для топлива, воздушный фильтр и шланг подачи топливной жидкости).
  2. Стартер (ручной или электрический), он используется для раскрутки основного вала с помощью специального троса.
  3. Система охлаждения работает под действием вращения коленчатого вала и подает холодный воздух при оборотах маховика.
  4. Система зажигания делает и подает искру в конструкции мотокультиватора.

Чем раньше вы поймете, где находится поломка в вашем устройстве, тем быстрее вы ее исправите и почините.

Большинство поломок происходит из-за неисправности мотора. Если же дело действительно в нем, то в таком случае нужно проверить:

  1. Разогрета ли эта часть, особенно зимой.
  2. Чистый ли воздушный фильтр.
  3. Исправность системы зажигания.
  4. Все ли поршневые элементы целы. Также нужно проверить, правильно ли стоит данная деталь (крепление и само место расположения).

Очистка карбюратора агрегата самостоятельно

Чаще всего нужно просто разобрать и почистить его. Детальную информацию об этом можно найти в руководстве по использованию мотокультиватора, где есть и чертеж оборудования. Все это для того, чтобы поплавок карбюратора равномерно погрузился обратно. Также требуется устранить деформацию кронштейна, с помощью которого поплавок устанавливается к поршневой системе. В этом поможет отвертка, все нужно проделывать четко и аккуратно.

Еще следует правильно настроить клапаны мотокультиватора. Для этого нужно исследовать плотность прилегания друг к другу, после этой процедуры функциональность карбюратора повышается и возвращает в норму употребляемое число бензина.

Ремонт насоса подачи топлива

Двигатель – это самая важная деталь в любом механизме, но часто он не заводится по некоторым причинам, например, когда есть проблемы с топливным насосом. Он работает, пока топливо поступает в насос, когда это не происходит, то насос ломается. В таком случае необходимо срочно осмотреть, разобрать, почистить и исправить все нарушения. Возможно, что насос загрязнен, тогда следует прочистить его и установить на место.

Важно! Если у вас двухтактный двигатель, и вы используете бензино-масляную смесь, то нужно обязательно промывать чистым бензином всю топливную систему.

Также мотор может глохнуть, тогда причина поломки может быть в плохой работе агрегата. Еще может быть проблема с зажиганием, здесь следует проверить свечи и если они неисправны, то нужно установить новые.

Если двигатель работает со стуком, то причина может быть в поврежденности одной из внутренних деталей (цилиндр, подшипник, поршень, возможно слетело кольцо с поршня). Здесь ремонт заключается в замене неисправных деталей новыми.

Также мотор культиватора может издавать гул. Проблема может быть в перегретом движке или использованию некачественного топлива. В таком случае советуется работать на немного меньшей скорости или заменить на качественный бензин.

Если же не работают лапы культиватора (фрезы), то больше всего это свидетельствует о том, что между ними что-то застряло и не дает продолжать нормально работать двигателю. Если же нет, то стоить проверить такие детали: крепление, шкив, положение промежуточной шестеренке и ремень привода. Если это так, то нужно просто сменить этот элемент или же поставить новый, так можно сделать со всем, кроме шкива. Его самостоятельно отремонтировать нельзя, следует отнести его в сервис.

Внимание! Очень часто бывают проблемы не в самой поломке того или иного элемента, а в обычном загрязнении, поэтому всегда непосредственно перед работой с мотокультиватором нужно проверить все детали на чистоту и исправность. Ведь чаще всего простое засорение влечет за собой много серьезных проблем и поломок.

Если проблемы с редуктором, нормально не удается задний ход, то нужно проверить исправность и целостность этой детали, ведь зачастую причиной поломки является застарелость этого элемента. Тогда нужно заменить не только сам редуктор, но и реверс.

Если есть проблемы с системой зажигания, то сначала необходимо проверить топливо, вывернув свечу. Если она мокрая – значит, оно поступает. Также нужно проверить наличие искры между электродами, в случае, если ее нет, то ищите поломку в цепочке генератора.

Если мощность двигателя теряет свою силу, то необходимо проверить карбюратор, бензошланг и воздушный фильтр, ведь проблемы с этими деталями зачастую происходят из-за их засорения или загрязнения.

Если в вашем мотокультиваторе отсутствует компрессия, то нужно проверить и заменить цилиндр, поршень и поршневые кольца.

Правила работы с мотокультиватором:

  1. Разогревать двигатель необходимо не меньше пяти минут и, только когда все узлы будут прогреты, можно преступать к работе.
  2. Для заправки использовать только качественную и свежую топливную смесь.
  3. Прогревать или работать с мотокультиватор чаще, нежели раз в три месяца.
  4. Вовремя менять сальники и смазывать редуктор (только качественной смазкой).
  5. Один раз в три месяца проверять и чистить воздушный фильтр.
  6. Нельзя, чтобы двигатель работал больше 10 минут в холостую. Это может привести к заклиниванию подшипника коленчатого вала.

Если следовать этим элементарным правилам, то вы увидите, насколько меньше стал ломаться ваш мотокультиватор и насколько дольше он вам прослужит.

Комплектация культиватора Крот МК-5-01

В коробке, помимо деталей, непосредственно необходимых для сборки самого мотокультиватора (рама с прикреплённым к ней двигателем, рукоятки, трубы, части фрез, крепёж и пр.) находились подробные инструкции по эксплуатации культиватора и двигателя Хонда для мотокультиватора Крот (см.

Комплект поставки мотокультиватора Крот

. Надо сказать, что все инструкции понятны, написаны доходчивым языком без злоупотребления техническими терминами.

Также в комплекте присутствовал набор инструментов, необходимый для сборки и обслуживания МК и брезентовая сумка для них. Этого набора инструментов достаточно для сборки и обслуживания мотокультиватора, но неплохо иметь под рукой ещё и набор отвёрток и трещётку с набором головок, для того чтобы быстрее и комфортнее собрать мотокультиватор.


Тип двигателябензиновый, 4х тактныйОбъем двигателя208 куб. смМощность двигателя7 л.с.

Видео обзоры

Общий обзор мотокультиватора Крот

Первый запуск мотокультиватора Крот

Открываем воздушную заслонку:

Дроссель ставим на половину (на фото рычажок в положении STOP, должен быть между STOP и MAX):

Дёргаем шнур стартера, мотокультиватор сразу заводится, прогреваем двигатель.
Нужно отметить, что при работе на мотокультиваторе в первый день проблем с запуском не наблюдалось. На следующий день запуск производился с 4-5 раза, через неделю двигатель культиватора перестал заводиться. Проблема исчезла и больше не появлялась после замены свечи зажигания.

Во время работы управление культиватором осуществляется при помощи рычагов, расположенных на обрезиненных рукоятках. Рукоятки удобно ложатся в руки, при этом хват становится более крепким. Мотокультиватором, несмотря на его полцентнера, управлять легко. При этом не нужно его толкать или наоборот удерживать. Нужно выбрать оптимальную скорость вращения роторов, и, идя за мотокультиватором, направлять его. Обработка почвы глубокая, если можно так выразиться, тщательная.

Левая рукоятка: дроссель, переключение переднего и заднего хода:

Правая рукоятка: рычаг управления сцеплением:

Глубина обработки почвы при фрезеровании зависит от положения сошника: чем глубже входит сошник в землю, тем глубже обработка. В инструкции рекомендуется начинать обработку почвы при небольшом заглублении сошника:

Передняя ручка МК Крот оказалась полезной не только для переноски мотокультиватора, но и во время обработки почвы для точного разворота культиватора в местах где нельзя передвигаться по большому радиусу:

Отзывы владельцев

В сети множество отзывов о данных моделях культиваторов, в основном владельцы отмечают их функциональность и надежность.


«Вот убедился на примере своего соседа – у него культиватор Крот выпуска 1985 года, сколько и мне лет. Так он каждый год на нем работает до сих пор. Правда в технике разбирается на высшем уровне. Каких только у него приспособлений нет – самоделок много. Еще и не было в продаже разных там пропольников и окучников, а он придумал, смастерил сам, без инструкции. Я себе тоже купил Крот с американским движком 5 лет назад. По отзыву соседа. Все работы на огороде, в саду, транспортировка, все с навеской делаю. Если кто выбирает, какой культиватор лучше, можете не сомневаться».

Габариты и масса

Масса50 кг

Перед покупкой уточняйте технические характеристики и комплектацию у продавца

Другие Мотоблоки и культиваторы DDE













Товары аналоги DDE V800 II Крот-3













Отзывы владельцев

Владимир, 42 года

«Купив “Крот” сразу же пустил его в работу. Поначалу очень расстроился, так как целина не поддавалась, “Крот” явно не справлялся со своей задачей. Но обратившись за советом к товарищу понял, что такие почвы с пылу-с жару не возьмешь, необходимо сначала обкатать двигатель, подготовить его к таким нагрузкам. Затем я узнал, что лучше пахать такую землю в несколько этапов, врезаясь с каждым разом все глубже и глубже. Дело пошло. За последние 7 лет (с момента покупки) прикупил все необходимое для посадки и копки картошки, в прошлом году обзавелся тележкой. В качестве сенокосилки не использовал, нет надобности. Так что теперь не жалею о покупке.»

Андрей, 28 лет

«Я купил “Крот” в 2014 году. Поначалу долго выбирал, изучал все слабые и сильные места и решил остановиться на культиваторе МК-5-01 с хондовским движком. Работает без передышки стабильно! За раз могу свободно взять 10 соток. Раму в прошлом году немного усилил, стараюсь держать его в чистоте — проблемы с зажиганием и т. д. мне ни к чему! За три года работы “Крот” отработал свою стоимость в разы!»

Мотоблок крот мк 1 – Дневник садовода minitraktor-pushkino.ru

Мотокультиваторы Крот МК-1А-02. Описание модели. Технические характеристики. Особенности эксплуатации


Вот уже более 35 лет на машиностроительных заводах в Омске и Москве выпускается ветеран полей, садов и огородов мотокультиватор Крот. За это время культиватор подвергался модернизации и различным усовершенствованиям, однако общая конструкция осталась практически неизменной. В настоящее время на культиваторы устанавливаются современные двигатели от известных производителей GeoTeck, Subaru, HAMMERMANN.

Мотокультиватор Крот МК-1А-02 предназначен для первичной обработки почвы, а также для прополки сорняков, окучивания рядков и грядок, транспортирования грузов, покоса травы, выкапывания картофеля, перекачки воды. Крот МК-1А-02 оснащен двухтактным двигателем мощностью 2,6 л.с. с увеличенным моторесурсом. В зависимости от количества установленных фрез способен обрабатывать грунт с шириной захвата 35-60 см. глубиной до 25 см.

По сравнению с базовой моделью МК-1А, современная версия МК-1А-02 выгодно отличается улучшенными техническими характеристиками и расширенным функционалом:

  • Благодаря увеличенной мощности двигателя, возросла производительность агрегата.
  • Небольшая масса позволяет легко управлять культиватором человеку даже с небольшой физической силой.
  • Агрегат можно удобно транспортировать в багажнике авто.
  • Доступная агрегация с различными дополнительными приспособлениями – оригинальными и других производителей.

Технические характеристики модели МК-1А-02

  • Двухтактный карбюраторный двигатель с воздушным охлаждением;
  • Мощность двигателя при 5500-6500 об./мин. — 1,9 кВт, 2.6 л.с.;
  • Топливо — смесь бензина А-76, АИ-80 с маслом М-12ТП;
  • Объем топливного бака — 1,8 л;
  • Ширина обработки — 350, 600 мм;
  • Одна передача — вперед;
  • Масса — 48 кг.;
  • Габаритные размеры в рабочем положении 1300x810x1060 мм.;
  • Глубина обработки — до 250 мм.;
  • Производительность при фрезеровании — 150-200 м 2 /час.

Инструкция по эксплуатации: особенности обслуживания

Мотокультиватор Крот МК-1А-02 прост в обслуживании и эксплуатации. Потребляет в качестве горючего смесь бензина АИ-76, АИ-80 с моторным маслом М-12-ТПТУ в соотношении 25:1. Для редуктора двигателя используется масло МГ-8А, для выходного редуктора ТАД-17.

Для нового культиватора первые 15 часов эксплуатации являются периодом обкатки – приработки основных узлов и механизмов. В этот период запрещается использовать технику на полную мощность.

На мотокультиватор доступно устанавливаются различные навесные орудия: окучники, пропольники, тележка, косилка, мотопомпа, плуг, снегоуборщик. Благодаря заднему ходу, агрегат обладает хорошей маневренностью, особенно на ограниченных пространствах в теплицах, на виноградниках.

Возможные неисправности, их устранение, ремонт

Каждый вид техники отличается определенными особенностями. Это относится и к мотокультиваторам Крот, поэтому неукоснительное соблюдение рекомендаций завода-изготовителя является залогом продолжительной бесперебойной работы машин.

Как свидетельствует опыт большинства владельцев техники, основные причины неполадок и поломок мотокультиватора Крот МК-1А-02 сводятся к одной: загрязнение деталей, узлов и механизмов. Поэтому поддержание сельхозмашины в чистоте и своевременное техническое обслуживание должно быть главным правилом успешной эксплуатации.

  • При загрязненном карбюраторе мотокультиватор Крот МК-1А-02 будет перегреваться и глохнуть.
  • Двигатель может не развивать достаточной мощности из-за засорения карбюратора, появления нагара в глушителе, на каналах цилиндра, засорения воздушного фильтра двигателя. Причинами также может быть увеличение натяжения клинового ремня, отсутствие компрессии.
  • Не используйте в качестве топлива чистый, не смешанный с маслом бензин.
  • Нельзя применять моторное масло тех марок, которые не указаны в инструкции по эксплуатации.
  • Запрещается работа двигателя на холостом ходу свыше 10 минут – вследствие низкого расходования горючего подшипник коленчатого вала охлаждается недостаточно, быстро перегревается, что может привести к заклиниванию.
  • Для легкого запуска двигателя своевременно очищайте дренажное отверстие в крышке топливного бака, фильтрующий элемент.
  • Из-за недостаточно прогрева двигателя, загрязненной свечи, неправильной установки наконечника провода высокого напряжения, двигатель может глохнуть или работать с перебоями.

Магнето – контроль системы зажигания

Тестирование системы производится визуально, с помощью щупа измеряют величину зазора между электродами. Для детального осмотра магнето снимают кожух и маховик, выполняют необходимые регулировки в соответствии с инструкцией.

При регулировке зазора, во избежание поломки, нельзя нажимать с силой на центральный электрод.

В инструкции по эксплуатации мотокультиватора Крот представлена очень подробная информация об устройстве агрегата, графике регламентных работ, настройке систем и механизмов, причинах неполадок и их устранении:

Видео обзор

Отзывы владельцев


«Культиватор Крот у меня уже много лет выполняет все работы в хозяйстве. И не только по обработке земли, но и по перевозке урожая. Простой агрегат, проще наверное некуда, хорошие характеристики. Главное топливную смесь правильно готовить, расходные вовремя менять, приспособиться к работе. Если почва плотная и культиватор норовит выскочить наверх, углубляю сошник с усилием, а дальше сам идет нормально. Поломок серьезных за 7 лет не было, только профилактика».

Мотокультиваторы Крот: обзор характеристик моделей

О мотокультиваторах марки Крот наслышаны многие фермеры и агрономы, ведь компания начала производство сельскохозяйственной техники еще в 80х годах и за весь период своей работы смогла доказать, что отечественные мотоблоки и мотокультиваторы ничем не уступают иностранной продукции по функциональности и надежности.

Мотокультваторы Крот – в чем причина популярности?

Эти культиваторы российского производства превосходят другие отечественные и некоторые импортные аналоги практически по всем параметрам. Такая техника позволяет установить плуг, фрезы и различные окучники. Эти модели успешно справляются с обработкой целины и тяжелых глинистых грунтов.

Как показывает практика, лучше всего эти агрегаты подходят для работы на участках, площадью не более 10 соток.

Отличительные особенности:

  • Наличие мощных двухтактных моторов, преимущественно Honda, мощностью от 2 до 8 л. с.;
  • Комплектация качественными редукторами, выдерживающими высокие нагрузки;
  • Наличие эргономичных ручек и удачное расположение органов управления;
  • Компактные габариты и небольшой вес;
  • Качественная заточка фрез;
  • Глубина обработки 0 от 12 до 25 см;
  • Ширина охватываемой полосы – 30–110 см.

Самой компактной моделью считается агрегат «Крот М», обладающий мощностью в 5 л. с. Он подходит для вспашки небольших участков с применением широкого спектра навесного оборудования. Если обрабатываемый участок имеет большую площадь, то стоит рассмотреть представителей ряда МК – они более мощные и надежные.

Мотокультиваторы Крот: детально рассматриваем самые популярные модели

Сегодня компания представляет на рынке невероятное разнообразие вариантов, поэтому, чтобы оценить все положительные особенности продукции, следует познакомиться с несколькими представителями бренда.

Культиватор крот МК-9-02

Этот агрегат считается одним из самых современных, поскольку он оснащен 4х-тактным двигателем Hammermann с верхним расположением кулачков. Немалая мощность и продуманность всех деталей превращают его в очень достойного соперника для приспособлений иностранного производства.

Технические характеристики:

  • Мощность двигателя – 5, 5 л. с.;
  • Вместительность топливного бака – 3, 6 л.;
  • Запуск – ручной;
  • Система зажигания – транзисторное магнето;
  • Используемое топливо – автомобильный бензин АИ-92, АИ-95;
  • Необходимое масло – SF, SG, SAE 30, SAE 10W-40;
  • Вес – 53, 2 кг.

Благодаря воздушной системе охлаждения удается продлить срок эксплуатации культиватора, тем самым избежав перегреваний и порчи деталей из-за высокой температуры. В том случае, если появляется необходимость в использовании ходоуменьшителей, можно пускать в ход колеса большого диаметра, которые будут оборачиваться гораздо медленней комплектационных и способствовать замедлению агрегата.

Мотокультиватор Крот МК-5-01

Благодаря удивительному сочетанию отточенной годами конструкционной специфики компании Крот и надежности японского двигателя Хонда, удалось создать устройство, отображающее самые выгодные особенности обеих организаций.

Технические характеристики:

  • Мощность двигателя – 4 л. с.;
  • Количество передач – 2;
  • Вместительность топливного бака – 1,7 л;
  • Результативность – 150-200 м 2 /час;
  • Используемое топливо – автомобильный бензин АИ-92, АИ-95;
  • Масса – 48 кг.

Повысить уровень производительности и расширить и без того широкий спектр реализуемых задач поможет специальное навесное оборудование, которое можно приобрести в магазинах или же попытаться сделать самостоятельно, ведь нередко простые самоделки оказываются более продуктивными чем дорогие вспомогательные детали.

Культиватор Крот МК-4-01

Агрегат дополнен двигателем известной американской компании «Briggs & Stratton», поэтому можно с уверенностью сказать, что мощности детали хватит на выполнение многих задач. 3,6 лошадиных сил будет достаточно для обработки небольшого земельного участка или внушительной приусадебной территории, рассчитанной на высадку овощей и корнеплодов.

Технические характеристики Крот МК-4-01:

  • Вместительность топливного бака – 1,8 л;
  • Тип топлива – бензин АИ-93, АИ-92;
  • Производительность в процессе фрезерования – 150-200 м 2 /час.
  • Глубина обработки – до 250 мм.;
  • Вес – 50 кг.

Немало радует, что такие агрегаты сопровождаются специальными инструкциями, где представлена информация по ремонту и подбору запчастей. Более того, подобные руководства подскажут, как измерить диаметр вала, заменить его, «привести в чувства» культиватор и все, что связано с ним.

Мотокультиватор Крот 1А

Мотокультиватор Крот МК 1А относится к наиболее популярным представителям сельхозтехники. Из-за высокого спроса на агрегат, производитель расширил модельный ряд этого семейства. Сегодня техника встречается в нескольких комплектациях, что дает возможность каждому из покупателей выбрать наиболее подходящий для себя вариант.

Современный мотокультиватор Крот 1А снабжается рукояткой с эргономичной формой. Модель весит немного больше своего предшественника, что повышает ее проходимость в процессе первичной обработки почвы. Помимо вспашки грунта, агрегат успешно справляется со многими другими задачами. Так, модель используется для:

  • Прополки грядок и удаления сорняков;
  • Окучивания грядок;
  • Сбора картофеля;
  • Покоса сена;
  • Перекачки воды;
  • Транспортировки небольших грузов.

Конечно, для всех этих работ необходимо отдельно приобретать нужный инвентарь. Окучник, колеса с грунтозацепами, картофелекопалка, плуги, косилка, тележка.

В зависимости от своей комплектации, модель может снабжаться 2-или 4-тактным мотором. Эксплуатация первого увеличивает ресурс агрегата, а использование второго повышает силовую тягу – это более удобно на заросших участках. Двигатель культиватора работает под воздушным охлаждением. Трансмиссия механическая, некоторые агрегаты могут двигаться только вперед. Самая легкая комплектация имеет вес в 48 кг. Благодаря этому агрегат отличается маневренностью на узких участках.

Культиватор Крот 1А обладает улучшенной конструкцией, что положительно влияет на его технические показатели. Агрегат отличается повышенной надежностью запчастей, отличным качеством сборки и наличием защиты от загрязнений и попадания воды.

Технические характеристики культиватора Крот 1А:

  • Крутящий момент двигателя составляет 5000–6500 об./мин.;
  • Мощность мотора – 2,6 л. с.;
  • Ширина обработки грунта регулируется, и может составлять от 35 до 60 см.;
  • Одна передняя скорость;
  • Глубина вспашки – не более 25 см.;
  • Средняя производительность составляет 170–200 квадратных метров за час работы.

Одним из преимуществ модели является ее небольшие габариты. Высота агрегата составляет 130, ширина – 81, а высота – 106 см. Благодаря сравнительно скромным размерам, агрегат успешно используется для работки грунта на клумбах, в парниках и небольших участках с обильными посадками.

Мотокультиватор Крот МК 1А 02

Рабочие показатели этой комплектации практически полностью идентичны с предыдущей моделью. Тем не менее, этот агрегат имеет некоторые конструктивные отличия. К ним относится:

  • Доработанная система сцепления – благодаря ей владельцу легче запускать агрегат. Кроме того, во время пуска мотор потребляет на 20 % меньше топлива;
  • Улучшенная трансмиссия – модель работает только на одной передней скорости, однако передача оборотов на вал происходит по укороченному маршруту, благодаря чему модель передвигается более уверенно;
  • Стабилизированная система охлаждения – мотор модели будет меньше перегреваться даже при очень сильных нагрузках. Таким образом, двигатель тратит меньше времени на охлаждение, а его обслуживание нужно выполнять реже;
  • Аппарат снабжается защитными пластинами, которые не дают воде и грязи попадать внутрь мотора и редуктора.

Спектр работ у модели МК 1А 02 достаточно широкий. Агрегат успешно используется для вспашки редко обрабатываемой почвы, он легко справляется с высокими сорняками, способен перекачивать большие объемы воды и косить сено.

Возникли неисправности с культиватором Крот? Что делать и как быть?

Представленная на нашем сайте универсальная инструкция по эксплуатации подойдет для решения проблем, связанных со всеми моделями производителя Крот. Отыскать достойные альтернативы оригинальным запчастям не сложно, ведь нередко в магазинах имеются необходимые детали. Стоит отметить, что к мотокультиваторам Крот зачастую подходят и китайские элементы.


Стоит всегда помнить, что руководство поможет разобраться с возникшей ситуации и позволит избавиться от проблемы даже своими руками.

Расход топлива культиваторами Крот

Большинство современных моделей оснащаются центробежным регулятором частоты вращения коленвала, который подключается непосредственно к мотору. Это позволяет снизить расход топлива моделями Крот. На понижение расхода также влияет воздушный фильтр, улучшенный карбюратор и наличие реверса, дающего возможность двигаться в заднем направлении.

В большинстве моделей расход топлива не превышает 1 л. смеси за час работы. Почти все агрегаты работают на низкооктановом бензине марки АИ-76. Бензин следует перемешивать с маслом М-12 ТП или МГ-8А. Объем топливного бака составляет 1,8 л.

Правила эксплуатации культиваторов Крот

В процессе использования техники производитель советует придерживаться определенных правил. К ним относиться:

  • Двигатель должен разогреваться не менее 5 минут;
  • Если агрегат не запускается с пятой подряд попытки, первым делом нужно проверить целостность троса сцепления;
  • Использовать для заправки только свежую топливную смесь;
  • Не держать культиватор без работы больше 3 месяцев;
  • Своевременно менять сальники и смазывать редуктор.
  • 1 раз в три месяца чистить или менять воздушный фильтр.

Все эти советы помогут продлить жизнь технике. Если вы заметите какую-либо неисправность, можно попытаться устранить ее самостоятельно. Однако если опыта в ремонте культиватора нет, то лучше не рисковать, и отвезти агрегат прямо к мастеру.

1 Отзыв

Отечественные бензиновые культиваторы Крот являются достаточно известными, так как они используются многими владельцами участков на протяжении 30 лет. Конструкция таких изделий дает возможность использовать различное навесное оборудование для выполнения работ по обработке земли.

Обзор мотокультиватора Крот МК-1А-02


Мотокультиватор Крот МК-1А-02

Мотокультиватор “Крот” МК-1А-02 выпускается отечественным заводом АО «ММП им. В.В. Чернышева». Первые агрегаты были выпущены производителем в 80-х годах прошлого века. Эти устройства, хоть и отличались (характеристиками, устройством, принципом запуска и работы, прицепным оборудованием и т. д.) от современного моторизированного культиватора “Крот” МК-1А-02 , но были оценены по достоинству владельцами огородов, теплиц (хозяйств небольшого размера). С самого момента появления “Крот” стал показателем надежности, прочности, функциональности и высокой технологичности.


Современный агрегат с маркировкой МК-1А-02 был модернизирован, в результате чего увеличилась его мощность (2,6 л/с) и, соответственно, производительность. Двухтактный двигатель, работающий на смешанном топливе (бензин + масло) способен обеспечить бесперебойную работу мотокультиватора на протяжении долгого времени. Сравнительно небольшой вес (всего 48 кг) позволяет без особого труда транспортировать технику в любое место, требующее обработки мотокультиватором.

С помощью культиватора Крот можно производить следующие агротехнические работы на участке:
  • вспашка грунта любой тяжести;
  • прорезание почвы под посев;
  • посадка картофеля;
  • окучивание посаженных растений;
  • прополка от сорняков;
  • выкопка картофеля;
  • покос;
  • уборка снега;
  • транспортировка грузов и т. д.

Все вышеописанные функции доступны со специальным навесным и прицепным оборудованием, которое можно купить или сделать самостоятельно ориентируясь на рисунки представленные в интернете.

Технические характеристики

Задний ход дается с трудом и редуктор подозрительно себя ведетНеобходимо проверить целостность компонента, потому что в большинстве случаев причиной проблем является изношенность. В таком случае следует заменить редуктор с реверсом.
Не заводится культиваторСкорее всего, проблема в электронном зажигании. Подобную ситуацию может создать срыв шнура пуска и неисправности в храповом механизме. Замена шнура решит проблему.
Двигатель потерял былую мощностьНужно прочистить карбюратор, продуть бензошланг и очистить воздушный фильтр.
Компрессия отсутствуетСледует заменить цилиндр, поршень и поршневые кольца.
ПроизводительАО «ММП им. В.В. Чернышева»
Страна производительРоссия
Диаметр фрез33 см.
Мощность2.6 л.с.
Количество скоростей1 вперед/0 назад
Рулевая колонка1 положение
Ширина захвата35-60 см.
Глубина захвата25 см.
Вес48 кг.
Габариты1300x810x1060 мм.

Инструкция по эксплуатации

Моторизированный культиватор МК-1А-02, кроме дополнительных функций, имеет основное предназначение — вспашка почвы. Для этого используются фрезы, которые насаживаются на вал, идущий от редуктора.

Настройка мотокультиватор перед вспашкой фрезой:

пневматические колеса приподнимаются, а движение агрегата происходит благодаря вращению фрез. В результате такого движения-рыхления происходит и вспахивание почвы.

  • в задней части агрегата крепится сошник на специальную прицепнуая скобу, выполняющий в данном случае роль тормоза.
  • Для почв более легких используется один-два комплекта фрез, для целинных грунтов — три (по 3 фрезы с каждой стороны мотокультиватора).

    Существует и другой способ вспашки почвы — с помощью оборотного навесного плуга, который крепится на место сошника, вместо фрез устанавливаются металлические колеса.

    В случае, когда необходимо провести другие агротехнические работы с агрегатом (прополка, посадка и т. д.), необходимо провести еще одно переоборудование мотокультиватора МК-1А-02.

    Настройка мотокультиватора в зависимости от задач:
    • При прополке растений с фрез снимаются ножи, а на их место устанавливаются полольники (эти приспособления имеют Г-образную форму). В случае с прополкой картофеля, установленный в задней части культиватора сошник будет выполнять роль окучника.
    • Окучивание картофеля осуществляется без фрез, вместо которых устанавливаются металлические колеса, оснащенные грунтозацепами. Вместо сошника ставится окучник.
    • Уборка картофеля производится следующим образом: впереди устанавливаются металлические колеса с грунтозацепами, а сзади цепляется навесное оборудование — картофелекопалка.
    • Если вы желаете использовать культиватор МК-1А-02 в качестве газонокосилки — купите саму косилку и закрепите ее в передней части мотоагрегата. Для осуществления движения необходимо на валах редуктора закрепить пневмоколеса, а передачу необходимого крутящего момента обеспечат ремни, которые необходимо надеть на шкивы косилки и самого культиватора.
    • Нужен насос — купите соответствующую насадку МНУ-2, закрепите ее на раме культиватора МК-1А-02 с помощью ременной передачи, не забыв отсоединить ремень тягового редуктора.
    • Перевозка грузов до 200 кг возможна со специальной тележкой (прицепом), которая оснащена особым сцепным механизмом (поворотным). Транспортировка грузов осуществляется с помощью пневмоколес.
    Краткий обзор навесного оборудования

    Более детально ознакомится с навесным оборудованием для мотокультиватора Крот можно по этой ссылке.

    Основные неисправности

    Мотокультиватор МК-1А-02 “Крот” иногда требует ремонта. Рассмотрим основные поломки, которые требуют незамедлительного вмешательства оператора и быстрого ремонта агрегата:

    • Отсутствие зажигания.
    • Загрязнение воздушного фильтра.
    • Поломка редуктора.
    • Греется и глохнет мотор.
    • Посторонние шумы в мотоблоке.
    Причин поломки агрегата может быть несколько:
    • Выход из строя или загрязнение свечи зажигания. В этом случае свечу необходимо либо хорошенько почистить и промыть, либо полностью заменить.
    • Проблемы со шлангом подачи бензина.
    • Нарушена изоляция высоковольтных проводов.
    • Проблемы в соединении проводов (электросеть не контачит).
    • Засорился фильтр. Его можно почистить, при сильных загрязнениях — заменить, благо, что эта запчасть всегда имеется в продаже.
    • Пластины маховика клинят магнитопроводы магнето.
    • Загрязнен карбюратор и потому машина глохнет (нагревается). Его необходимо тщательно вымыть, если неисправность не исчезает — заменить.
    • При наличии посторонних шумов долейте масла.
    • Заглох мотор — посмотрите, не закончилось ли топливо.
    • Обратите внимание на редуктор, возможно следует подтянуть болты и гайки, или же заменить сальники.

    Как вы заметили, чаще всего причиной быстрого нагревания двигателя на мотокультиваторе “Крот” МК-1А-02 является его загрязнение, а затем идут неполадки с электроникой и проводкой.

    Содержите мотокультиватор МК-1А-02 “Крот” в чистоте и ремонт вам долго не понадобится.

    Магнето МБ-1 схема для мотокультиватора “Крот”

    Предлагаем вам ознакомиться с усовершенствованной схемой магнето к мотокультиватору МК-1 “Крот”.

    Видео обзор

    Чтобы увидеть мотокультиватор в работе, а также еще перед покупкой агрегата оценить его возможности, предлагаем посмотерть видео обзор.

    Общий обзор мотокультиватора Крот

    Отзывы владельцев

    Что же говорят об этой агротехнике наши эксперты — обычные владельцы дачных участков и огородов, которым посчастливилось купить мотокультиватор “Крот”? Давайте ознакомимся с несколькими отзывами:

    Иван Андреевич, 54 года

    «В целом, мотокультиватор МК-1А-02 “Крот” мне очень нравится! Пользуюсь этой машиной уже 17 лет, агрегат зарекомендовал себя как надежная техника. За все время эксплуатации было несколько серьезных поломок: накрылся магнето — пришлось заменить, первое время глох движок, но я быстро усек в чем дело — тщательно прочистил карбюратор и впредь с неочищенным от пыли, грязи мотоблоком на работу не выходил. Пару раз приходилось в процессе вспашки поля подтягивать крепежные болты, машина сразу прекращала тарахтеть, как трещетка. Ну, что еще — сальники менял пару раз. Функционал впечатляющий, пришлось подкупить кое-какое оборудование, некоторое сделал сам (снегоуборщик). Мужики, рекомендую всем — не пожалеете!»

    Василий, 39 лет

    «Первый мотокультиватор Крот был еще у моего отца. Так что при покупке я уже наперед понимал, что покупаю. Меня все устраивает: и очень доступная цена, и хорошая производительность. Читал отзывы, что мол мотоблок для целины не годится — слабоват, отвечу — если пройтись несколькими этапами, да в разных направлениях — подчинится и целина! Купили с женой дом с большим участком, земля такая — думали ничего не получится! Но мотокультиватор приятно удивил, медленно, потихонечку взяли мы эту целину. Здесь главное знать как и не отступать!»

    Мотокультиватор Крот МК-1А

    Благодаря высокой в своё время популярности мотокультиватор Крот МК-1А обзавёлся парой модификаций, которые несколько отличаются своими характеристиками, сохраняя всё же сходство с оригиналом. При этом сходство заключается не только в качестве работы, но и во внешних признаках. Встретить его можно где угодно, т.к. выпускается он с начала 80-х прошлого века.

    Мотокультиватор Крот МК-1А в работе

    Устройство мотокультиватора Крот МК-1А

    По сравнению со своим предшественником мотокультиватор Крот МК-1А новой модификации имеет более эргономичную форму рукоятей, а также больший вес, что увеличивает проходимость при первичной обработке грунта. Помимо основного своего назначения — вспашки почвы, он со значительным успехом справляется с рядом других задач, среди которых числятся:

    • Прополка сорняков;
    • Окучивание грядок;
    • Выкапывание картофеля;
    • Сенокос;
    • Перекачка воды;
    • Перевозка небольших грузов.

    Однако для выполнения данных операций потребуется приобретать дополнительно комплект навесного оборудования, состоящий из таких элементов:

    • полольников;
    • окучивателя;
    • колёс с грунтозацепами;
    • выкапывателя;
    • плуга;
    • косилки;
    • насосной установки;
    • тележки.

    Такая оптимизация позволяет классифицировать инструмент не как мотокультиватор, а как мотоблок.

    В зависимости от комплектации он может иметь 2-х или 4-хтактный двигатель. При использовании первого увеличивается моторесурс изделия, а во втором случае повышается силовая тяга, что гораздо удобнее на сложно проходимых участках. Мотор у мотокультиватора имеет воздушное охлаждение. Переключение передач у него – механическое, однако, в некоторых версиях движение может осуществляться только вперёд.
    Самый облегчённый вариант мотокультиватора Крот МК-1А имеет вес – 48 кг, что обеспечивает ему отличную мобильность в междурядьях.

    Внешний вид мотокультиватора Крот МК-1А

    Расхода топлива культиватора Крот МК-1А

    Экономичный расход топлива обеспечивается за счёт использования центробежного регулятора частоты вращения коленчатого вала, подключённого к двигателю. Также этому способствует переработанный карбюратор и воздушный фильтр, а также реверсивный режим работы, обеспечивающий задний ход. В целом расход топлива не превышает 1 литра за час работы. В качестве основного вида топлива применяется низкооктановый бензин марки А-76 в смеси с маслом МГ-8А или М-12 ТП. Для удобства работы ёмкость топливного бака ограничивается объёмом 1,8 литра.

    Технические характеристики культиватора Крот МК-1А

    • Двухтактный карбюраторный двигатель с воздушным охлаждением;
    • мощность двигателя при 5500-6500 об./мин. — 1,9 кВт, 2.6 л.с.; (зависит от модели)
    • объем топливного бака — 1,8 л;(зависит от медели)
    • ширина обработки — 350, 600 мм;
    • одна передача – вперед;
    • масса – 48 кг.;(зависит от модели)
    • габаритные размеры в рабочем положении 1300x810x1060 мм.;
    • глубина обработки — до 250 мм.;
    • производительность при фрезеровании — 150-200 м2/час.

    Видео о мотокультиватора Крот МК-1А

    Мотокультиватор «Крот» – особенности и техническое обслуживание

    Ведение фермерского хозяйства неизменно связано с использованием определённых орудий труда. Учитывая, что выращивание урожая, это сложный и многоступенчатый процесс, у каждого фермера должен иметься внушительный арсенал.

    Если большие поля обрабатываются тракторами, дополненными различными видами навесного оборудования, дачники вынуждены обходиться шанцевым инструментом: лопатами, граблями и мотыгами. Ведь использование трактора на небольших участках земли экономически невыгодно.

    Однако с этой задачей неплохо справляются мотоблоки. Эти устройства комплектуются несколькими разновидностями дополнительного оборудования, что позволяет вспахивать, культивировать и мульчировать землю.

    Кроме того, при помощи мотоблока можно скашивать траву и даже перевозить собранный урожай на небольшие расстояния. Среди данной категории спецтехники выделяется мотокультиватор «Крот». Темой статьи будут технические особенности и возможные неполадки данной модели культиватора.

    Общая информация

    Мотокультиватор «Крот» — это наиболее яркий представитель советской промышленности. Первые модификации поступили в серийное производство в 80-х годах прошлого века. Производственные линии находились в Москве и Омске.

    Техника несколько раз модернизировалась, с учётом всех требований ведения приусадебного хозяйства и обработки небольших участков земли. Несмотря на почти сорокалетнюю историю, «Крот» довольно часто встречается на территории России и постсоветского пространства.

    Конструкция агрегата включает в себя стальную раму, редуктор, силовую установку и рукояти управления. На заводские модели устанавливаются бензиновые двигатели, мощностью около 6.5 л. с.

    Обратите внимание, что на приусадебных участках можно встретить мотокультиватор «Крот» с двигателем Лифан. Замена силовой установки проводится фермерами самостоятельно, при этом необходимо приобрести шкив к двигателю.

    При помощи культиватора «Крот» можно выполнить полный цикл работ на приусадебном участке. В частности, фрезерование почвы на глубину до 25 сантиметров, рыхление и перемешивание земли с растительными остатками сорняков, прополка междурядий.

    Обратите внимание, что в случае поломки достать запчасти для «Крота» не составит особого труда. 

    Технические характеристики культиватора рассмотрим на примере модели «Крот» МК 1А 02

    Габариты: длина/ширина/высота 1 300/810/1 060 мм.
    Конструкционная масса 48 кг.
    Двигатель Двухтактный, бензиновый, с воздушным охлаждением
    Мощность силовой установки 2.6 л. с.
    Рекомендуемое топливо АИ-76; АИ-80
    Объём топливного бака 1.8 л.
    Охватываемая площадь 350-600 мм.
    Средняя производительность До 200 м2 за единицу времени

    Для всех моделей предусмотрены дополнительные груза, которые повышают устойчивость культиватора и сцепление с обрабатываемой поверхностью. Кроме того, применяются съёмные колёса, что упрощает транспортировку и хранение культиватора.

    В базовой комплектации, культиваторы «Крот» идут с почвенной фрезой. Для предпосадочной подготовки дачного участка, этого навесного оборудования будет вполне достаточно.

    В случае необходимости, можно дополнительно приобрести следующее элементы:

    1. Окучник для ухода за овощными культурами.
    2. Косилку, для удаления лишней травы на участке.
    3. Насос – обеспечивает подачу воды для полива и удобрения растений.
    4. Тележка: предназначена для перевозки малогабаритных грузов по территории участка.

    Возможные неисправности

    Как и любая другая техника советского образца, «Крот» довольно надёжен в эксплуатации, и нетребователен в плане технического обслуживания.

    По отзывам фермеров, культиватор способен отработать 12-15 сезонов, без постановки на капитальный ремонт. Однако поломки неизбежны, но их можно устранить самостоятельно, не прибегая к помощи специалистов.

    Обратите внимание, что агрегат не содержит сложных узлов. Кроме того, в базовой комплектации идёт инструкция к мотокультиватору, где описаны наиболее часто встречающиеся проблемы и рекомендации к их устранению.

    Рассмотрим, как самостоятельно устранить возникающие неисправности.

    • Не заводится двигатель. Возможно, проблема кроется в неисправном зажигании. Для решения проблемы нужно снять и осмотреть свечу зажигания. Если она сухая, значит, в рабочий цилиндр не поступает топливная смесь. В случае, когда свеча влажная, рекомендуется просушить цилиндр или прокачать стартером двигатель.
    • Отсутствует искра. В данной ситуации необходимо заменить свечу зажигания или отрегулировать зазор между электродами. Рекомендуемые параметры: 0.8 мм. Не забудьте проверить состояние электрической проводки, и состояние воздушного фильтра.
    • Двигатель работает нестабильно. Необходима регулировка карбюратора, проверка состояния или замена топливного фильтра.

    Обратите внимание, что приведённые выше проблемы встречаются из-за несоблюдения правил эксплуатации. Чтобы избежать неисправностей, перед началом работы культиватор должен пройти обкатку.

    Это необходимо для притирки подвижных элементов редуктора и двигателя. Не соблюдение этих требований может привести к механическим повреждениям силовой установки, с последующей заменой двигателя.

    Советуем обратить внимание на срок гарантийного обслуживания. Если установленное производителем время на гарантийный ремонт не истекло, не стоит предпринимать самостоятельных действий по ремонту оборудования. Такое вмешательство в конструкцию повлечёт автоматический отказ в гарантийном ремонте.

    Отдельно стоит упомянуть о консервации культиватора. Большинство фермеров не используют технику в зимний период, поэтому нужно грамотно подготовить оборудование к длительному хранению.

    1. Перед хранением нужно полностью слить остатки топлива. Для этого двигатель запускают до полного опустошения карбюратора.
    2. Затем смазывают все трущиеся детали маслом, и помещают культиватор в сухое помещение. Перед началом сезона, технику испытывают при небольших нагрузках, проводят повторную смазку узлов и элементов.
    3. В период эксплуатации, необходимо периодически смазывать культиватор, проверять натяжение приводных ремней и подтягивать резьбовые соединения.






    Похожие статьи:

    Мотокультиватор крот мк 1а 01ц

    Мотокультиваторы Крот МК-1А-02. Описание модели. Технические характеристики. Особенности эксплуатации


    Вот уже более 35 лет на машиностроительных заводах в Омске и Москве выпускается ветеран полей, садов и огородов мотокультиватор Крот. За это время культиватор подвергался модернизации и различным усовершенствованиям, однако общая конструкция осталась практически неизменной. В настоящее время на культиваторы устанавливаются современные двигатели от известных производителей GeoTeck, Subaru, HAMMERMANN.

    Мотокультиватор Крот МК-1А-02 предназначен для первичной обработки почвы, а также для прополки сорняков, окучивания рядков и грядок, транспортирования грузов, покоса травы, выкапывания картофеля, перекачки воды. Крот МК-1А-02 оснащен двухтактным двигателем мощностью 2,6 л.с. с увеличенным моторесурсом. В зависимости от количества установленных фрез способен обрабатывать грунт с шириной захвата 35-60 см. глубиной до 25 см.

    По сравнению с базовой моделью МК-1А, современная версия МК-1А-02 выгодно отличается улучшенными техническими характеристиками и расширенным функционалом:

    • Благодаря увеличенной мощности двигателя, возросла производительность агрегата.
    • Небольшая масса позволяет легко управлять культиватором человеку даже с небольшой физической силой.
    • Агрегат можно удобно транспортировать в багажнике авто.
    • Доступная агрегация с различными дополнительными приспособлениями – оригинальными и других производителей.

    Технические характеристики модели МК-1А-02

    • Двухтактный карбюраторный двигатель с воздушным охлаждением;
    • Мощность двигателя при 5500-6500 об./мин. — 1,9 кВт, 2.6 л.с.;
    • Топливо — смесь бензина А-76, АИ-80 с маслом М-12ТП;
    • Объем топливного бака — 1,8 л;
    • Ширина обработки — 350, 600 мм;
    • Одна передача — вперед;
    • Масса — 48 кг.;
    • Габаритные размеры в рабочем положении 1300x810x1060 мм.;
    • Глубина обработки — до 250 мм.;
    • Производительность при фрезеровании — 150-200 м 2 /час.

    Инструкция по эксплуатации: особенности обслуживания

    Мотокультиватор Крот МК-1А-02 прост в обслуживании и эксплуатации. Потребляет в качестве горючего смесь бензина АИ-76, АИ-80 с моторным маслом М-12-ТПТУ в соотношении 25:1. Для редуктора двигателя используется масло МГ-8А, для выходного редуктора ТАД-17.

    Для нового культиватора первые 15 часов эксплуатации являются периодом обкатки – приработки основных узлов и механизмов. В этот период запрещается использовать технику на полную мощность.

    На мотокультиватор доступно устанавливаются различные навесные орудия: окучники, пропольники, тележка, косилка, мотопомпа, плуг, снегоуборщик. Благодаря заднему ходу, агрегат обладает хорошей маневренностью, особенно на ограниченных пространствах в теплицах, на виноградниках.

    Возможные неисправности, их устранение, ремонт

    Каждый вид техники отличается определенными особенностями. Это относится и к мотокультиваторам Крот, поэтому неукоснительное соблюдение рекомендаций завода-изготовителя является залогом продолжительной бесперебойной работы машин.

    Как свидетельствует опыт большинства владельцев техники, основные причины неполадок и поломок мотокультиватора Крот МК-1А-02 сводятся к одной: загрязнение деталей, узлов и механизмов. Поэтому поддержание сельхозмашины в чистоте и своевременное техническое обслуживание должно быть главным правилом успешной эксплуатации.

    • При загрязненном карбюраторе мотокультиватор Крот МК-1А-02 будет перегреваться и глохнуть.
    • Двигатель может не развивать достаточной мощности из-за засорения карбюратора, появления нагара в глушителе, на каналах цилиндра, засорения воздушного фильтра двигателя. Причинами также может быть увеличение натяжения клинового ремня, отсутствие компрессии.
    • Не используйте в качестве топлива чистый, не смешанный с маслом бензин.
    • Нельзя применять моторное масло тех марок, которые не указаны в инструкции по эксплуатации.
    • Запрещается работа двигателя на холостом ходу свыше 10 минут – вследствие низкого расходования горючего подшипник коленчатого вала охлаждается недостаточно, быстро перегревается, что может привести к заклиниванию.
    • Для легкого запуска двигателя своевременно очищайте дренажное отверстие в крышке топливного бака, фильтрующий элемент.
    • Из-за недостаточно прогрева двигателя, загрязненной свечи, неправильной установки наконечника провода высокого напряжения, двигатель может глохнуть или работать с перебоями.

    Магнето – контроль системы зажигания

    Тестирование системы производится визуально, с помощью щупа измеряют величину зазора между электродами. Для детального осмотра магнето снимают кожух и маховик, выполняют необходимые регулировки в соответствии с инструкцией.

    При регулировке зазора, во избежание поломки, нельзя нажимать с силой на центральный электрод.

    В инструкции по эксплуатации мотокультиватора Крот представлена очень подробная информация об устройстве агрегата, графике регламентных работ, настройке систем и механизмов, причинах неполадок и их устранении:

    Видео обзор

    Отзывы владельцев


    «Культиватор Крот у меня уже много лет выполняет все работы в хозяйстве. И не только по обработке земли, но и по перевозке урожая. Простой агрегат, проще наверное некуда, хорошие характеристики. Главное топливную смесь правильно готовить, расходные вовремя менять, приспособиться к работе. Если почва плотная и культиватор норовит выскочить наверх, углубляю сошник с усилием, а дальше сам идет нормально. Поломок серьезных за 7 лет не было, только профилактика».

    Обзор мотокультиватора Крот МК-1А-02


    Мотокультиватор Крот МК-1А-02

    Мотокультиватор “Крот” МК-1А-02 выпускается отечественным заводом АО «ММП им. В.В. Чернышева». Первые агрегаты были выпущены производителем в 80-х годах прошлого века. Эти устройства, хоть и отличались (характеристиками, устройством, принципом запуска и работы, прицепным оборудованием и т. д.) от современного моторизированного культиватора “Крот” МК-1А-02 , но были оценены по достоинству владельцами огородов, теплиц (хозяйств небольшого размера). С самого момента появления “Крот” стал показателем надежности, прочности, функциональности и высокой технологичности.


    Современный агрегат с маркировкой МК-1А-02 был модернизирован, в результате чего увеличилась его мощность (2,6 л/с) и, соответственно, производительность. Двухтактный двигатель, работающий на смешанном топливе (бензин + масло) способен обеспечить бесперебойную работу мотокультиватора на протяжении долгого времени. Сравнительно небольшой вес (всего 48 кг) позволяет без особого труда транспортировать технику в любое место, требующее обработки мотокультиватором.

    С помощью культиватора Крот можно производить следующие агротехнические работы на участке:
    • вспашка грунта любой тяжести;
    • прорезание почвы под посев;
    • посадка картофеля;
    • окучивание посаженных растений;
    • прополка от сорняков;
    • выкопка картофеля;
    • покос;
    • уборка снега;
    • транспортировка грузов и т. д.

    Все вышеописанные функции доступны со специальным навесным и прицепным оборудованием, которое можно купить или сделать самостоятельно ориентируясь на рисунки представленные в интернете.

    Технические характеристики

    ПроизводительАО «ММП им. В.В. Чернышева»
    Страна производительРоссия
    Диаметр фрез33 см.
    Мощность2.6 л.с.
    Количество скоростей1 вперед/0 назад
    Рулевая колонка1 положение
    Ширина захвата35-60 см.
    Глубина захвата25 см.
    Вес48 кг.
    Габариты1300x810x1060 мм.

    Инструкция по эксплуатации

    Моторизированный культиватор МК-1А-02, кроме дополнительных функций, имеет основное предназначение — вспашка почвы. Для этого используются фрезы, которые насаживаются на вал, идущий от редуктора.

    Настройка мотокультиватор перед вспашкой фрезой:

    пневматические колеса приподнимаются, а движение агрегата происходит благодаря вращению фрез. В результате такого движения-рыхления происходит и вспахивание почвы.

  • в задней части агрегата крепится сошник на специальную прицепнуая скобу, выполняющий в данном случае роль тормоза.
  • Для почв более легких используется один-два комплекта фрез, для целинных грунтов — три (по 3 фрезы с каждой стороны мотокультиватора).

    Существует и другой способ вспашки почвы — с помощью оборотного навесного плуга, который крепится на место сошника, вместо фрез устанавливаются металлические колеса.

    В случае, когда необходимо провести другие агротехнические работы с агрегатом (прополка, посадка и т. д.), необходимо провести еще одно переоборудование мотокультиватора МК-1А-02.

    Настройка мотокультиватора в зависимости от задач:
    • При прополке растений с фрез снимаются ножи, а на их место устанавливаются полольники (эти приспособления имеют Г-образную форму). В случае с прополкой картофеля, установленный в задней части культиватора сошник будет выполнять роль окучника.
    • Окучивание картофеля осуществляется без фрез, вместо которых устанавливаются металлические колеса, оснащенные грунтозацепами. Вместо сошника ставится окучник.
    • Уборка картофеля производится следующим образом: впереди устанавливаются металлические колеса с грунтозацепами, а сзади цепляется навесное оборудование — картофелекопалка.
    • Если вы желаете использовать культиватор МК-1А-02 в качестве газонокосилки — купите саму косилку и закрепите ее в передней части мотоагрегата. Для осуществления движения необходимо на валах редуктора закрепить пневмоколеса, а передачу необходимого крутящего момента обеспечат ремни, которые необходимо надеть на шкивы косилки и самого культиватора.
    • Нужен насос — купите соответствующую насадку МНУ-2, закрепите ее на раме культиватора МК-1А-02 с помощью ременной передачи, не забыв отсоединить ремень тягового редуктора.
    • Перевозка грузов до 200 кг возможна со специальной тележкой (прицепом), которая оснащена особым сцепным механизмом (поворотным). Транспортировка грузов осуществляется с помощью пневмоколес.
    Краткий обзор навесного оборудования

    Более детально ознакомится с навесным оборудованием для мотокультиватора Крот можно по этой ссылке.

    Основные неисправности

    Мотокультиватор МК-1А-02 “Крот” иногда требует ремонта. Рассмотрим основные поломки, которые требуют незамедлительного вмешательства оператора и быстрого ремонта агрегата:

    • Отсутствие зажигания.
    • Загрязнение воздушного фильтра.
    • Поломка редуктора.
    • Греется и глохнет мотор.
    • Посторонние шумы в мотоблоке.
    Причин поломки агрегата может быть несколько:
    • Выход из строя или загрязнение свечи зажигания. В этом случае свечу необходимо либо хорошенько почистить и промыть, либо полностью заменить.
    • Проблемы со шлангом подачи бензина.
    • Нарушена изоляция высоковольтных проводов.
    • Проблемы в соединении проводов (электросеть не контачит).
    • Засорился фильтр. Его можно почистить, при сильных загрязнениях — заменить, благо, что эта запчасть всегда имеется в продаже.
    • Пластины маховика клинят магнитопроводы магнето.
    • Загрязнен карбюратор и потому машина глохнет (нагревается). Его необходимо тщательно вымыть, если неисправность не исчезает — заменить.
    • При наличии посторонних шумов долейте масла.
    • Заглох мотор — посмотрите, не закончилось ли топливо.
    • Обратите внимание на редуктор, возможно следует подтянуть болты и гайки, или же заменить сальники.

    Как вы заметили, чаще всего причиной быстрого нагревания двигателя на мотокультиваторе “Крот” МК-1А-02 является его загрязнение, а затем идут неполадки с электроникой и проводкой.

    Содержите мотокультиватор МК-1А-02 “Крот” в чистоте и ремонт вам долго не понадобится.

    Магнето МБ-1 схема для мотокультиватора “Крот”

    Предлагаем вам ознакомиться с усовершенствованной схемой магнето к мотокультиватору МК-1 “Крот”.

    Видео обзор

    Чтобы увидеть мотокультиватор в работе, а также еще перед покупкой агрегата оценить его возможности, предлагаем посмотерть видео обзор.

    Общий обзор мотокультиватора Крот

    Отзывы владельцев

    Что же говорят об этой агротехнике наши эксперты — обычные владельцы дачных участков и огородов, которым посчастливилось купить мотокультиватор “Крот”? Давайте ознакомимся с несколькими отзывами:

    Иван Андреевич, 54 года

    «В целом, мотокультиватор МК-1А-02 “Крот” мне очень нравится! Пользуюсь этой машиной уже 17 лет, агрегат зарекомендовал себя как надежная техника. За все время эксплуатации было несколько серьезных поломок: накрылся магнето — пришлось заменить, первое время глох движок, но я быстро усек в чем дело — тщательно прочистил карбюратор и впредь с неочищенным от пыли, грязи мотоблоком на работу не выходил. Пару раз приходилось в процессе вспашки поля подтягивать крепежные болты, машина сразу прекращала тарахтеть, как трещетка. Ну, что еще — сальники менял пару раз. Функционал впечатляющий, пришлось подкупить кое-какое оборудование, некоторое сделал сам (снегоуборщик). Мужики, рекомендую всем — не пожалеете!»

    Василий, 39 лет

    «Первый мотокультиватор Крот был еще у моего отца. Так что при покупке я уже наперед понимал, что покупаю. Меня все устраивает: и очень доступная цена, и хорошая производительность. Читал отзывы, что мол мотоблок для целины не годится — слабоват, отвечу — если пройтись несколькими этапами, да в разных направлениях — подчинится и целина! Купили с женой дом с большим участком, земля такая — думали ничего не получится! Но мотокультиватор приятно удивил, медленно, потихонечку взяли мы эту целину. Здесь главное знать как и не отступать!»

    Мотокультиватор Крот МК-1А

    Благодаря высокой в своё время популярности мотокультиватор Крот МК-1А обзавёлся парой модификаций, которые несколько отличаются своими характеристиками, сохраняя всё же сходство с оригиналом. При этом сходство заключается не только в качестве работы, но и во внешних признаках. Встретить его можно где угодно, т.к. выпускается он с начала 80-х прошлого века.

    Мотокультиватор Крот МК-1А в работе

    Устройство мотокультиватора Крот МК-1А

    По сравнению со своим предшественником мотокультиватор Крот МК-1А новой модификации имеет более эргономичную форму рукоятей, а также больший вес, что увеличивает проходимость при первичной обработке грунта. Помимо основного своего назначения — вспашки почвы, он со значительным успехом справляется с рядом других задач, среди которых числятся:

    • Прополка сорняков;
    • Окучивание грядок;
    • Выкапывание картофеля;
    • Сенокос;
    • Перекачка воды;
    • Перевозка небольших грузов.

    Однако для выполнения данных операций потребуется приобретать дополнительно комплект навесного оборудования, состоящий из таких элементов:

    • полольников;
    • окучивателя;
    • колёс с грунтозацепами;
    • выкапывателя;
    • плуга;
    • косилки;
    • насосной установки;
    • тележки.

    Такая оптимизация позволяет классифицировать инструмент не как мотокультиватор, а как мотоблок.

    В зависимости от комплектации он может иметь 2-х или 4-хтактный двигатель. При использовании первого увеличивается моторесурс изделия, а во втором случае повышается силовая тяга, что гораздо удобнее на сложно проходимых участках. Мотор у мотокультиватора имеет воздушное охлаждение. Переключение передач у него – механическое, однако, в некоторых версиях движение может осуществляться только вперёд.
    Самый облегчённый вариант мотокультиватора Крот МК-1А имеет вес – 48 кг, что обеспечивает ему отличную мобильность в междурядьях.

    Внешний вид мотокультиватора Крот МК-1А

    Расхода топлива культиватора Крот МК-1А

    Экономичный расход топлива обеспечивается за счёт использования центробежного регулятора частоты вращения коленчатого вала, подключённого к двигателю. Также этому способствует переработанный карбюратор и воздушный фильтр, а также реверсивный режим работы, обеспечивающий задний ход. В целом расход топлива не превышает 1 литра за час работы. В качестве основного вида топлива применяется низкооктановый бензин марки А-76 в смеси с маслом МГ-8А или М-12 ТП. Для удобства работы ёмкость топливного бака ограничивается объёмом 1,8 литра.

    Технические характеристики культиватора Крот МК-1А

    • Двухтактный карбюраторный двигатель с воздушным охлаждением;
    • мощность двигателя при 5500-6500 об./мин. — 1,9 кВт, 2.6 л.с.; (зависит от модели)
    • объем топливного бака — 1,8 л;(зависит от медели)
    • ширина обработки — 350, 600 мм;
    • одна передача – вперед;
    • масса – 48 кг.;(зависит от модели)
    • габаритные размеры в рабочем положении 1300x810x1060 мм.;
    • глубина обработки — до 250 мм.;
    • производительность при фрезеровании — 150-200 м2/час.

    Видео о мотокультиватора Крот МК-1А

    ТОП-5 моделей ручных мотокультиваторов Крот

    Мотокультиватор Крот является ценным инструментом для частного земледелия, который позволяет бороться с сорняками, обрабатывать, рыхлить и подкармливать почву, а также проводить другие действия. Уже больше 35 лет продукция этого бренда занимает лидирующие позиции на российском рынке, являясь одной из наиболее востребованных. Это объясняется ее надежностью, функциональностью и высоким качеством сборки.


    Устройство мотокультиватора Крот предусматривает наличие следующих рабочих узлов:

    1. Редуктор.
    2. Рычажные механизмы.
    3. Топливный резервуар.
    4. Рама.
    5. Силовой агрегат.
    6. Опора.
    7. Колесо.
    8. Режущие элементы.

    Для передачи крутящего момента используется редуктор, установленный на двигателе. Острые ножи способствуют быстрой срезке пластов почвы на глубину до 25 см, их смешиванию и измельчению. За счет небольшого веса и габаритов управлять таким агрегатом достаточно комфортно.

    На ручке расположены рычаги, обеспечивающие переключение сцепления и интенсивности оборотов. Флагманские разработки оборудованы рычагом заднего и переднего хода. Свободное передвижение по грядкам обеспечивается прочными колесами, которые легко демонтируются и устанавливаются обратно.

    Силовые установки оснащены системой воздушного охлаждения и ручным тросовым стартером. Еще они поддерживают бесконтактный запуск.

    Характеристики двигателя на мотокультиватор Крот МК 5 01 выглядят таким образом:

    1. Объем — 60 см³.
    2. Показатели мощности — 4,8 кВт.
    3. Количество об/м — 5,5-6,5 тыс.
    4. Емкость топливного резервуара — 1,8 л.

    Мотор и механизмы трансмиссии соединены в 1 цельный узел. Редуктор обладает 1 передачей с движением через ремень А750 и шкив 19 мм. Для выжимания сцепления необходимо надавить на рукоять.

    Навесное оборудование

    В магазинах для садоводов и дачников предлагается всевозможное навесное оборудование для культиватора Крот.

    Это расширяет его функциональность и позволяет выполнять широкий спектр работ по обработке и вспахиванию почвы.

    Передовые модели обладают следующими навесками и прицепами:

    1. Фреза. Представляет собой ключевой режущий элемент для вспахивания земли. В его качестве используются стальная фреза диаметром 33 см, оборотный плуг. Узлы закрепляются с задней части стальной цепкой.
    2. Окучник. При необходимости окучивания садово-огородных культур понадобится приобрести специальные механизмы, предварительно сняв острые фрезы и заменив их колесами с грунтозацепами.
    3. Полольник и сошник. С целью борьбы со стремительно растущими сорняковыми растениями фермеры оснащают культивирующие агрегаты полольником и сошником. Они навешиваются прямо на фрезу вместо острых ножей.
    4. Картофелесажалка КС-01Ц и картофелевыкапыватели. Работы по посадке и сборке урожая картофеля требуют больших усилий и затрат. Для упрощения предстоящего занятия, можно оснастить мотокультиватор Крот МК 9 01 полезными насадками. Для посева семян зерновых или овощных культур используются специальные сеялки.
    5. Косилка. Приспособление позволяет заготавливать сено для домашнего скота. Его размещают на редукторном валу, соединяя ремешки со шкивами.
    6. Насосные станции и насос. Их необходимо задействовать, чтобы организовать бесперебойную подачу воды к огороду.
    7. Тележка. Подобная прицепная конструкция разработана для транспортировки тяжелых грузов с одного места на другое.
    8. Снегоотвалы. Предназначаются для расчистки приусадебной территории от снега. Модели роторного типа способны избавиться от тонкой наледи. С помощью простой переделки их можно сделать полноценным средством для убора снега.
    9. Культиваторы бензиновые Крот оснащаются плугом.

    Наличие перечисленного оборудования позволит решить важные задачи за короткое время.

    Модели и их характеристики

    Стремительное развитие современных технологий позволило бренду Крот выпустить на рынок модели с широким функционалом и хорошими техническими характеристиками. Наиболее популярными агрегатами считаются следующие:

    Модель является наименьшей в своей серии и работает на базе двухтактного карбюраторного двигателя, мощностью 2,6 л. с. Еще есть модификация МК-1А- 02, которая немного мощнее. Но даже при миниатюрных размерах и небольшой производительности такой агрегат может обрабатывать большие территории, а процесс его перемещения не требует больших усилий.

    Устройства востребованы для работ в парниках и теплицах. У них отсутствует опция задней передачи, поэтому движение осуществляется только вперед на 1 передаче. Культиватор Крот МК-1А весит всего 48 кг.


    Агрегат намного крупнее предыдущего, а его масса равна 51 кг. При этом он свободно помещается в багажнике автомобиля и оснащен достаточно мощным движком GioTeck (3,5 л. с.).

    Отличительными особенностями модели можно назвать:

    1. Наличие задней передачи.
    2. Более усовершенствованные технико-эксплуатационные характеристики, способствующие комфортному применению бензинового или электрокультиватора.


    Модель весит 53 кг и поставляется с двигателем Briggs&Stratton, мощность которого составляет 4 л.с. Устройство имеет только 1 передачу — переднюю. Его отличают улучшенные способности захвата почвы, что обеспечивает качественное выполнение сельскохозяйственных работ.


    Культиватор Крот 5 мало чем отличается от предыдущей модели, за исключением нового движка от Honda с повышенной выносливостью при аналогичных мощностных свойствах. Его принято использовать для обработки небольших огородов и теплиц на даче. Мощность мотора можно отрегулировать, изучив руководство по использованию мотоблоков.


    Считается высокопроизводительным устройством, работающим на базе двигателя для мотокультиватора Крот Hammermann мощностью до 5 л. с. Повышенная производительность способствует эффективной обработке тяжелых грунтов и целины, а комфортные габариты позволяют работать с агрегатом в течение нескольких часов без ощущения усталости.

    Инструкция по эксплуатации

    Бензиновый и электрический культиватор Крот является надежным и функциональным приспособлением, однако срок его службы напрямую зависит от соблюдения инструкции по эксплуатации.

    Существует ряд правил, которых нужно придерживаться при использовании мотоблока.

    Техническое обслуживание

    Поскольку бензиновые модели работают за счет сгорания топливной смеси и моторного масла, необходимо придерживаться заводских пропорций компонентов, создавая смесь. В противном случае двигатель вскоре выйдет из строя.

    Отзывы владельцев на тематических форумах подчеркивают, что использовать аналоги рекомендованного производителем масла М-8В нельзя, поскольку они не обладают требуемыми параметрами.

    Перед запуском и началом работы нужно убедиться в затяжке крепежных элементов и проверить работоспособность клиноременной передачи, заднего хода и рабочих систем. Следует ознакомиться с уровнем топлива и масла, а по необходимости оценить состояние воздушных фильтров.

    В течение первых 15-20 часов выполняется обкатка оборудования с установленными навесными орудиями. В этот период разрешается эксплуатация агрегата на небольших нагрузках, а вспахивание земли осуществляется в 2-3 захода на глубину не больше 10 см.

    Замена масла в редукторе силовой установки осуществляется через 5 часов работы, в редукторе ходовой — через 25 моточасов.

    Дальнейший технический осмотр предусматривает базовое обслуживание с очисткой машины от загрязнений и смазывания рабочих узлов на культиваторе Крот специальными маслами.

    Подготовка к хранению

    Если мотокультиватор Крот 2 не будет эксплуатироваться в течение 2-3 месяцев, важно избавиться от топливной смеси в карбюраторе и выполнить простое обслуживание. Если машина будет находиться на длительном простое, в цилиндр следует поместить 70 см³ моторного масла и легкими движениями повернуть коленвал.

    Поверхность механизмов протирается смоченной в топливной смеси ветошью.

    Возможные неисправности и ремонт

    В процессе эксплуатации мотоблока могут возникать разные поломки и сбои. Из-за этого у фермеров появляется желание отремонтировать агрегат Крот своими руками. В большинстве случаев проблемы возникают с такими рабочими органами:

    1. Двигатель.
    2. Магнето, система зажигания.
    3. Редуктор.
    4. Воздушные фильтры.
    5. Карбюратор.

    Чтобы понять, как осуществить ремонт культиватора Крот, следует подробно разобраться с основными причинами неполадок и их решением.

    Как завести

    Если мотокультиватор Крот не заводится, возможно это связано со следующими поломками и проблемами:

    1. Отсутствие искры. Возможно произошло перегорание искры зажигания. Для устранения дефекта нужно заменить свечу.
    2. Свеча покрылась копотью. Чтобы восстановить ее работоспособность, достаточно выполнить глубокую чистку бензином.
    3. При наличии хорошей искры, но отсутствии запуска двигателя, следует посмотреть на качество изоляции. Порой возникает необходимость замены наконечника.
    4. Низкое качество топливной смеси.
    5. Стекание топлива со свечи.
    6. Проблемы с воздушным фильтром. Если он покрылся загрязнениями, проблем с зажиганием не избежать.
    7. Повреждение магнето. Подобный узел нельзя восстановить, поэтому понадобится покупка нового.

    Как заменить двигатель

    Необходимость замены двигателя возникает при его выходе из строя. Проблема часто связана с отсутствием или низким качеством топливной смеси, неполадках в системе зажигания или декомпрессии, вызвавшей износ поршня и деформацию выпускного клапана.

    Если неприятность объясняется некачественным топливом, то достаточно заменить его. При наличии более опасных поломок придется выполнить установку двигателя Хонда, Лифан, Субару или другой модели.

    Установить движок самостоятельно несложно. Главное — придерживаться схемы, где указаны требуемые параметры монтажа.

    Как выставить зажигание

    В случае неисправностей в системе зажигания необходимо проверить работоспособность свечи, предварительно выкрутив ее и осмотрев.

    Если приспособление сухое, значит топливная смесь не достигает цилиндров.

    Мокрая свеча отображает важность просушки цилиндров с помощью ручного стартера. Исправность свечи проверяется мультиметром, который определяет показатели напряжения в ОМ.


    В случае выхода из строя магнето восстановить его будет невозможно. Единственным решением станет покупка нового исправного устройства.


    Роль редуктора заключается в передаче вращательного момента от мотора к валу. Если он выйдет из строя, работа мотоблока окажется невозможной. Чтобы восстановить систему, необходимо разобраться с ее устройством и спецификой ремонта.

    Задний ход

    Современные модели культиваторов Крот оснащаются опцией реверса (задней передачи), которая расширяет их функциональность и эксплуатационные свойства. Выход из строя реверсной передачи случается редко, но если это произойдет, понадобится заменить ее.

    Замена ремня

    Заменяя ремень, необходимо определить его размер и рабочие свойства. Их описание указывается в технической документации к мотокультиватору.

    Как отрегулировать карбюратор

    Регулировка карбюратора К60В является важным этапом технического обслуживания. Чтобы провести ее, необходимо изучить конструктивные особенности и строение сельскохозяйственной машины. Чтобы поменять частоту оборотов и наладить подачу топливной смеси, задействуется 2 винта:

    1. Винт числа оборотов.
    2. Винт подачи топлива.

    После зимнего простоя перед запуском культиватора необходимо разобрать карбюратор и выполнить его чистку.

    Гиалуронан голого землекопа с очень высокой молекулярной массой проявляет превосходные цитопротекторные свойства

    Культура клеток

    NSF и MSF были выделены в нашей лаборатории 43 из кожи молодых взрослых мышей ЯМР и мышей C57BL / 6J, соответственно. Фибробласты кожи выделяли из образцов кожи умерщвленных животных путем измельчения и переваривания их 0,14 единиц Вунча / мл Liberase TM (Roche Diagnostics) в среде DMEM / F12 при 37 ° C в течение 60 мин. Все животные содержались в соответствии с правилами, установленными и утвержденными Комитетом по животным ресурсам Университета Рочестера (UCAR), который придерживается рекомендаций FDA и NIH по уходу за животными и рассматривает все протоколы для животных до утверждения.Фибробласты легких человека IMR90 были получены из Института медицинских исследований Кориелла. Клетки HEK293T были из АТСС. Клетки NSF, MSF и IMR90 культивировали в EMEM с добавлением 15% FBS. NSF культивировали при 32 ° C, 4,8% CO 2 , 2,8% O 2 . Клетки MSF и IMR90 культивировали при 37 ° C, 5% CO 2 , 4% O 2 . Число пассажей клеток NSF, MSF и IMR90 было менее 20, 5 и 40 соответственно. В клетках IMR90 последовательность всех экзонов p53 была проверена с использованием наших данных RNA-Seq, и было обнаружено отсутствие мутаций.Подсчет клеток производился с использованием чашек для культивирования с сеткой.

    Анализ апоптоза

    Апоптотические клетки определяли количественно с использованием набора для обнаружения апоптоза аннексина-V (eBioscience) в соответствии с инструкциями производителя. После окрашивания клетки анализировали с помощью проточного цитометра LSR-II (BD Biosciences).

    Препарат НА

    Для очистки НА кондиционированные среды сначала смешивали с раствором протеиназы К (конечные концентрации 1 мМ Трис-Cl pH 8,0, 2,5 мМ ЭДТА, 10 мМ NaCl, 0.05% SDS, 1 мг / мл протеиназы K) и инкубировали при 55 ° C в течение 4 часов. После переваривания белка среду экстрагировали насыщенным фенол-хлороформ-изоамиловым спиртом (Sigma). ГК осаждали этанолом и центрифугировали (4000 × г в течение 45 мин). Осадок НА растворяли в PBS и затем экстрагировали 1/100 объема Triton-X114 44 . После экстракции Triton-X114 HA снова осаждали этанолом. Наконец, осадок НА промывали 70% этанолом и растворяли в PBS. Для экстракции геля vHMM-HA NSF-HA запускали на 0.7% легкоплавкая агароза (бляшка Agarose-LM; Nacalai Tesque) в буфере TBE. Маркерную полосу отрезали от геля и окрашивали, как описано ниже. NSF-HA-содержащий гель с маркерной полосой выше 6,1 МДа был отрезан и vHMM-HA был выделен из геля с использованием термостабильной агаразы (ген Nippon) в соответствии с инструкциями производителя. Выделенный vHMM-HA затем экстрагировали PCI и Triton-X114 и осаждали этанолом, как описано выше. Концентрацию HA измеряли с помощью анализа карбазола 45 . Streptomyces HAase (Sigma) использовали для деградации HA в кондиционированной среде и для частичной фрагментации HA. HA частично фрагментировали путем инкубации с 0,5 ед. / Мл HAase при 37 ° C в течение 60 минут с последующей тепловой инактивацией при 95 ° C в течение 10 минут. Select-HA TM был разработан Echelon Biosciences. Для блокирования взаимодействий HA / CD44 в культуральную среду добавляли нейтрализующее антитело CD44 (клон 2C5; R&D) в концентрации 10 нг / мл.

    Экстракция РНК, обратная транскрипция и кПЦР в реальном времени

    Полную РНК экстрагировали с помощью RNAiso Plus (Takara) и обратно транскрибировали в кДНК с помощью случайных гексамеров с использованием набора реагентов PrimeScript (Takara).КПЦР в реальном времени выполняли с использованием TB Green TM Premix Ex Taq II TM (Takara) с системой ПЦР в реальном времени Step ONE Plus (Life Technologies). В этом исследовании использовались следующие праймеры: ACTB, вперед, AGATCAAGATCATTGCTCCTCCTG; ACTB обратный GCCGGACTCGTCATACTCCT; CD44 вперед, TGGTGAACAAGGAGTCGTCA; CD44 обратный, ACACCCCAATCTTCATGTCC; PRRX2 вперед, AGGTGCCTACGGTGAACTGA; PRRX2 обратный, CTGCCCCCTTTTCTATTGCT; PYCARD вперед, TGACGGATGAGCAGTACCAG; PYCARD реверс, CAGGCTGGTGTGAAACTGAA; RHAMM вперед, AGCAAGAAGGCATGGAGATG; RHAMM обратный, CCCTCCAGTTGGGCTATTTT; RRM2B вперед, GCCAGGACTCACTTTTTCCA; RRM2B обратный, TCCCTGACCCTTTCTTCTGA.

    Гель-электрофорез в импульсном поле

    Очищенную ГК смешивали с раствором сахарозы (конечная концентрация 333 мМ) и загружали в 0,4% -ный агарозный гель SeaKem Gold (Lonza). HA-Ladders (Hyalose) запускали вместе с образцами. Образцы обрабатывали 12 ч при 4 ° C и 75 В с рабочим соотношением 1–10 в буфере TBE с использованием системы CHEF-DRII (Bio-Rad). После эксперимента гель окрашивали 0,005% (мас. / Об.) Stains-All (Santa Cruz) в 50% этаноле в течение ночи. Затем гель дважды промывали 10% этанолом, подвергали воздействию света для уменьшения фона и фотографировали с помощью системы ChemiDoc Imaging System (Bio-Rad).

    Иммунофлуоресцентное окрашивание

    Клетки промывали PBS и фиксировали 4% формальдегидом при комнатной температуре в течение 15 мин. После фиксации клетки промывали 3% BSA / PBS и повышали проницаемость 0,5% Triton X-100 / PBS при комнатной температуре в течение 20 мин. Затем клетки промывали 3% BSA / PBS и блокировали блокирующим буфером (10% FBS и 1% BSA в PBS) при комнатной температуре в течение 1 часа. Затем клетки инкубировали с антителами γh3AX (JBW301; Millipore; 1: 500) и 53BP1 (ab172580; Abcam; 1: 500) в блокирующем буфере при 4 ° C в течение ночи и промывали PBST.Наконец, клетки инкубировали с козьим антителом против мышиного IgG Alexa Fluor 488 и козьим антителом против кроличьего IgG Alexa Fluor 568 (Thermo Fisher Scientific; 1: 1000) в блокирующем буфере при комнатной температуре в течение 1 ч, промывали PBST и помещали в Vectashield. содержащий DAPI (Vector Laboratories). Изображения были получены с помощью конфокального микроскопа Leica SP5.

    Создание клеток IMR90 с избыточной экспрессией CD44

    Клетки IMR90 с избыточной экспрессией CD44 и CD44-FLAG были установлены с помощью вирусной трансдукции и отбора пуромицина с концентрацией 1 мкг / мл.Клетки IMR90 со сверхэкспрессией CD44-FLAG дополнительно трансдуцировали ретровирусным вектором, несущим CD44-YFP, и отбирали с помощью FACS (Sony SH800). Ретровирусный супернатант получали путем котрансфекции клеток HEK293T векторами VSV-G, pUMVC и pBabe-puro. Пустые векторы pBabe для экспрессии CD44s были получены от Addgene (№ 1764 и № 19127). CD44 были клонированы в pcDNA3.1-ZNF598-TEV-3xFLAG (# 105690, Addgene) и pcDNA3-YFP (# 13033, Addgene) для создания CD44-FLAG (C-конец) и CD44-YFP (C-конец), соответственно. .CD44-FLAG и CD44-YFP затем клонировали обратно в вектор pBabe для продуцирования вируса.


    Клетки инкубировали с 20 мкг / мл cNSF-HA, fNSF-HA или эквивалентным объемом PBS в течение 6 часов, затем среду удаляли и клетки перекрестно связывали в PBS, содержащем 500 мкМ DSP и 500 мкМ DSP. мкМ DTME (Thermo Fisher Scientific) в течение 30 мин при комнатной температуре. Сшивание гасили инкубацией с PBS, содержащим 20 мМ трис-Cl (pH 7,4) и 5 ​​мМ L-цистеин (Sigma). Клетки собирали в буфере RIPA (50 мМ Трис, pH 7.4, 150 мМ NaCl, 1% NP-40, 0,5% дезоксихолевая кислота, 0,1% SDS) с добавлением полного коктейля ингибиторов протеаз (Sigma). После лизиса клеток буфер заменяли 0,05% TBST с использованием колонки Vivaspin (MWCO = 10 кДа) (GE Healthcare). Иммунопреципитацию проводили из 200 мкг лизатов с 6 мкг антител против CD44 (3 мкг антитела Abcam против CD44 (каталожный ab157107) и 3 мкг антитела Proteintech против CD44 (каталожный 15675-1-AP)). нормальный кроличий IgG (Cell Signaling Technology), антитело против FLAG (M2; сигма) или нормальный мышиный IgG (CST) с использованием магнитных шариков Dynabeads Protein G (Thermo Fisher Scientific).Перед иммунопреципитацией антитела связывали с шариками с помощью DMP (Thermo Fisher Scientific). Иммунопреципитанты элюировали путем инкубации с буфером RIPA с добавлением 50 мМ DTT в течение 20 мин при 70 ° C.


    CD44-иммунопреципитанты расщепляли трипсином и очищали с использованием колонки S-Trap (Protifi). Пептиды отправляли в Ресурсную лабораторию масс-спектрометрии Университета Рочестера для мечения 10-plex TMT и масс-спектрометрии. Образцы разделяли ионизацией наноэлектрораспылением на приборе Orbitrap Fusion Lumos MS.Определение пептидов производили с использованием Proteome Discoverer и Sequest, а ионы MS3 использовали для количественной оценки содержания белка.

    Анализ транскриптома

    РНК экстрагировали с использованием Trizol (Invitrogen). Образцы РНК были отправлены в Исследовательский центр геномики Университета Рочестера для RNA-Seq. Для создания библиотеки использовали комплект TruSeq RNA Sample Preparation Kit V2 (Illumina). Библиотеки гибридизовали с односторонней проточной кюветой Illumina и амплифицировали с использованием cBot (Illumina) в концентрации 8 пМ на дорожку.Для каждого образца были получены односторонние чтения по 100 нт. Секвенирование выполняли с использованием высокопроизводительного HiSeqTM 2500 компании Illumina. Нормализацию и анализ дифференциальной экспрессии проводили с использованием DESeq2 46 . Онтологические анализы и анализ путей проводились с использованием программы Enrichr 26 . Анализ обогащения TFBS проводили с использованием программы oPOSSUM 27 . Параметры, использованные в oPOSSUM, были следующими: граница сохранения = 0,4, порог оценки матрицы = 85%, анализируемые последовательности = 2 т.п.н. перед сайтами начала транскрипции, отсечка по Z-баллу = 10, граничная оценка по шкале Фишера = 7.

    Количественное определение внутриклеточных ROS

    Количественное определение внутриклеточных уровней ROS проводили с использованием флуоресцентного зонда H 2 DCFDA. Клетки предварительно инкубировали в течение 6 часов с 20 мкг / мл NSF-HA или эквивалентным объемом PBS, затем с 5 мкМ H 2 DCFDA в HBSS в течение 30 минут, а затем подвергали воздействию 200 мкМ tBHP в течение 1 часа и промыт HBSS. Флуоресценцию DCF измеряли при возбуждении при Ex485 / Em530 нм и нормализовали по количеству клеток.


    Лизаты целых клеток получали лизированием клеток в буфере для лизиса (20 мМ Трис, pH 7.5, 250 мМ NaCl, 1% N-лаурилсаркозин, 10 мМ NaF, 2 мМ ортованадат натрия, 1 мМ β-глицерофосфат) с добавлением коктейля комплексных ингибиторов протеаз (Sigma). Ядерные и цитоплазматические лизаты получали с использованием набора Nuclear Extract Kit (abcam, ab113474). Лизаты и иммунопреципитаты денатурировали при 95 ° C (70 ° C для обнаружения CD44) в течение 10 мин в буфере Лэммли. Белки разделяли с помощью SDS-PAGE, переносили на нитроцеллюлозные мембраны, блокировали 5% BSA или 5% молока в TBST в течение 1 часа и зондировали следующими первичными антителами: анти-β-актином (sc-47778; Santa Cruz), анти-CD44 (ab157107; abcam), анти-FLAG (M2; сигма), анти-GFP (для обнаружения YFP) (ab6556; abcam), анти-h4 (# 9715; CST), анти-p53 (человеческий) (10442 -1-AP; Proteintech), анти-p53 (мышиный) (ab26; Abcam), анти-фосфо-p53 (Ser-9) (# 9288; CST), анти-фосфо-p53 (Ser-15) (# 9286 ; CST), антифосфо-p53 (Ser-46) (# 2521; CST) и антифосфо-p53 (Thr-81) (# 2676; CST).Все первичные антитела разводили до 1 мкг / мл. После промывки TBST мембраны инкубировали со вторичными антителами (Sigma) (1: 1000) в течение 1 ч при комнатной температуре (RT), снова промывали TBST и визуализировали с помощью реагентов с усиленной хемилюминесценцией. Не обрезанные изображения гелей представлены на дополнительном рисунке 10.


    RNAi получали путем трансфекции siRNA с использованием реагента для трансфекции RNAiMAX (Thermo Fisher Scientific). Конечная концентрация миРНК составляла 50 нМ.Последовательности олигонуклеотидов миРНК были следующими. си-люцифераза: CGUACGCGGAAUACUUCGAtt. si-CD44: GAACGAAUCCUGAAGACAUCUtt 47 . si-RHAMM: GCUAGAUAUUGCCCAGUUAtt 48 . si-p53: AAGACUCCAGUGGUAAUCUACtt 35 .

    Статистика и воспроизводимость

    Планки погрешностей представлены в виде среднего значения ± стандартное отклонение. Двусторонний тест Стьюдента t и односторонний дисперсионный анализ ANOVA с апостериорным двусторонним тестом Даннета использовали для оценки статистической значимости, если не указано иное.Точные значения p представлены в файле исходных данных. Все реплики являются биологическими.

    Сводка отчетов

    Дополнительная информация о дизайне исследований доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

    Контроль ущерба от кротов и полевок

    Контроль ущерба от кротов и полевок

    Ущерб вашему имуществу могут нанести кроты или полевки.Знание разницы между двумя животными необходимо для решения проблемы.

    Кроты и полевки, хотя и прокладывают туннели, различаются по поведению и типу ущерба, который они наносят газонам, садам и сельскому хозяйству. Из-за этого методы, используемые для контроля их деятельности, не совпадают. Прежде чем действовать, вы должны знать, кто ваш противник.

    Рис. 1. Крот (а) связан с землеройкой. У него длинный нос и перепончатые передние лапы с острыми когтями для рытья.Полевка (б) из семейства грызунов меньше по размеру, у нее короткие хвост и ноги.

    Физически кроты и полевки разные.

    Южные кроты ( Scalopus aquaticus) имеют длину от 6 до 7 дюймов и вес от 3 до 4 унций. У них маленькие отверстия для глаз и ушей, а также заостренный нос, который выступает примерно на полдюйма за пределы рта. Их большие передние лапы перепончатые и имеют острые когти, которые помогают копать (рис. 1а).

    Полевки от 4 до 6 дюймов в длину, у них короткие ноги и хвосты, а также маленькие глаза и уши.В Алабаме есть два вида. Чаще всего встречается сосновая или лесная полевка ( Microtus pinetorum), которая встречается по всему штату в лесных массивах (рис. 1b). Вторая – степная полевка ( Microtus ochrogaster), обитающая только в северной трети штата.

    Родинки – плотоядные животные; полевки – травоядные.

    Кроты едят белых личинок, дождевых червей, жуков и различных личинок. Они действительно могут принести пользу растениям, питаясь личинками и червями, которые повреждают растения.Полевки питаются травами, разнотравьем и иногда корой деревьев.

    У кротов и полевок разные среды обитания.

    Кроты образуют знакомую систему приподнятых туннелей на газонах. Обычно они живут поодиночке, хотя самки и детеныши могут находиться в одной норе. Они строят кормовые туннели и норы для гнезд в сухой теплой почве под деревьями или прочными конструкциями. Похоже, они предпочитают прохладную влажную почву (такую ​​же предпочитают личинки и дождевые черви).

    Полевки имеют подземные тоннельные системы.Они ищут пищу на приусадебном участке площадью около четверти акра и редко заходят в открытые места. Их предпочтительная среда обитания – районы с плотным почвенным покровом, такие как естественная среда, фруктовые сады, поля и сады.

    Полевки дают больше потомства.

    полевок гнездятся круглый год. У них может быть до пяти пометов от шести потомков. Продолжительность жизни полевок составляет всего от 2 до 16 месяцев. Популяция достигает пика каждые 2–5 лет. В это время плотность полевок может стать довольно высокой, а участки, на которых не было повреждений, могут внезапно получить серьезные повреждения.Кроты размножаются в марте-апреле. Беременность составляет примерно 5 недель, а размеры помета варьируются от двух до пяти потомков. Из-за одиночной природы кротов вы можете найти только пять или шесть моль на акр.

    Полевки убивают растения; родинок обычно нет.

    Люди, пострадавшие от полевок, обычно описывают следующие сценарии: однажды мое маленькое деревце выглядело здоровым, на следующий день оно умерло. Или: «Однажды мой цветник был прекрасен, а на следующий день растения увяли и умирали.При более внимательном осмотре можно обнаружить крошечные следы зубов вокруг растения на уровне земли или то, что корневая система исчезла.

    Кроты редко вызывают обширный ущерб растениям. Однако их прокладывание туннелей может изуродовать газоны и сады (рис. 2 и рис. 3). Наибольший риск представляют норы, которые смываются во время проливных дождей, что создает угрозу безопасности. Самый очевидный признак поражения полевками – мертвое или умирающее растение. Чувствительны огороды, декоративные насаждения и молодняк.Полевки могут туннелировать рядом с корневой системой, поедая корни и жевая или «опоясывая» основной стебель прямо над землей.

    Рисунок 2. Смытая нора кротов может обезопасить газон.
    Рис. 3. Эта линия голой земли – это место, где через двор проложил туннель крот.
    Рисунок 4. Ствол небольшого кизила со всей корневой структурой, поеденной полевками.Домовладелец сообщил, что однажды с деревом все было хорошо; на следующий день листья увяли. А на следующий день домовладелец без особых усилий вытащил дерево из земли, и это все, что осталось.

    Повреждения, нанесенные полевками, можно спутать с повреждениями, нанесенными кроликами. Чтобы определить виновника, посмотрите на образец грызения или жевания. У полевок маленькие зубы, которые оставляют на растении небольшие неровные следы грызунов под разными углами (рис. 4). У кроликов более широкие зубы, на которых остаются более широкие следы.Кроме того, кролики часто разрезают растение пополам равномерным срезом под углом 45 градусов.

    Репелленты и токсиканты обычно неэффективны для борьбы с повреждениями кротов. Одна из трудностей с токсикантами – заставить кротов принять наживку. Смертельные или биологические меры контроля являются наиболее эффективными.


    Летальные ловушки обычно бывают трех типов: гарпунные (рис. 6), ножничные (рис. 8) и колье. Любой из них хорошо работает, если установлен правильно, но тип почвы может повлиять на эффективность.Гарпунные ловушки более эффективны на песчаных почвах, а ловушки с ножницами и чокерами более эффективны на суглинистых почвах или почвах с более высоким содержанием глины.

    Перед установкой ловушек вы должны определить, какие кротовые туннели или участки используются наиболее часто. Чтобы это выяснить, сгладьте туннели, наступив на них или используя каток для газона. На следующий день посмотрите, какие из них снова появились. Поставьте ловушки в эти новые туннели.

    При использовании ловушки для гарпуна дайте ловушке несколько раз спрыгнуть в землю перед окончательной постановкой.Это гарантирует, что гарпуны могут беспрепятственно пройти в туннель.

    При установке ловушек с ножницами или чокерами выкопайте часть земли вокруг туннеля и поместите ловушку в яму (рис. 7, 8 и 9). Снова засыпьте яму почвой (рис. 10), убедившись, что в туннель не проникает свет. Рекомендуется надеть резиновые или латексные перчатки, чтобы запах не попал в ловушку. После установки ловушки не ходите по туннелям и не трогайте их.

    Иногда ловушки можно активировать, не поймав крота, поэтому ежедневно проверяйте ловушки и сбрасывайте их при необходимости. Если крот не использует туннель с ловушкой через несколько дней, переместите ловушку в другой туннель. Как только ловушка установлена, обязательно снимите предохранитель.

    Биологические меры контроля

    Чтобы добиться несмертельного контроля над кротами, необходимо исключить источник пищи. Это включает применение инсектицидов для борьбы с популяциями личинок. С белыми личинками можно бороться естественным путем, внося в почву молочно-споровую болезнь.Хотя эти методы могут быть эффективными, они не быстрые. Может пройти некоторое время, прежде чем запасы пищи сократятся настолько, чтобы повлиять на популяцию кротов.

    Полевки обычно не выходят на открытую территорию; Следовательно, изменение среды обитания путем устранения почвенного покрова может быть эффективным в уменьшении ущерба.


    Отлов полевок при крупномасштабных операциях не рентабелен, но может быть полезен в цветниках или небольших огородах. Ставьте ловушки размером с мышь на входе в туннели / взлетно-посадочные полосы.Наживите ловушки смесью арахисового масла и овсянки или нарезанных яблок. Установите ловушки так, чтобы спусковой крючок был обращен ко входу в туннель.

    Биологические меры контроля

    Газоны, прилегающие к цветникам, должны быть скошены до небольшой высоты, чтобы полевки не заходили в сад для кормления. Также минимизируйте количество мульчи в цветниках и часто переворачивайте мульчу, чтобы они не создавали туннельные системы. Очистите задние кольца или насыпи мульчи на расстоянии не менее 3 футов от корней деревьев.В сельскохозяйственных условиях обработка почвы разрушает систему туннелей. Это помогает сократить популяцию полевок и последующий ущерб.

    Змеи, ястребы, совы и другие хищники питаются полевками, если им предоставляется возможность. Однако у полевок чрезвычайно высокий репродуктивный потенциал, поэтому сомнительно, что одни хищники могут предотвратить ущерб.

    Несмотря на то, что родинки могут быть полезны при борьбе с газонными насекомыми, многие люди считают их вредными для озеленения и хотят их удалить.Отлов и биологический контроль – два наиболее многообещающих методов борьбы с повреждениями кротов.

    Ущерб от полевок может варьироваться от года к году по мере увеличения и уменьшения численности популяции. Ущерб декоративным и огородным угодьям, наносимый полевками, может служить основанием для борьбы с изменением среды обитания и отловом. Комбинация методов контроля обычно дает наилучшие результаты контроля.

    Загрузите PDF-файл «Контроль повреждений от кротов и полевок», ANR-2412.

    Загрузите эту статью в формате PDF

    Считаете ли Вы это полезным?